Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14751  (registered. 2007)
Contig Information
Length 1392 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os06g0148200 [Oryza sativa (japonica cultivar-group)] >gi|37780986|gb|AAP33477.1| putative lipase [Oryza sativa (japonica cultivar-group)] >gi|55297050|dbj|BAD68619.1| putative nodulin [Oryza sativa Japonica Group] >gi|55297149|dbj|BAD68792.1| putative nodulin [Oryza sativa Japonica Group] >gi|113594848|dbj|BAF18722.1| Os06g0148200 [Oryza sativa (japonica cultivar-group)] >gi|125554087|gb|EAY99692.1| hypothetical protein OsI_21674 [Oryza sativa Indica Group] >gi|215765665|dbj|BAG87362.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215766575|dbj|BAG98734.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1471
Evalue 6.24556e-161
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14751
gtgaaaaaaacacggtgatccatcaaatttgaaggacatgcaag*aaaaagAAAAGAAAAGATCCAGTGCTTGCACCCATAACTTCGAGCTTTTCGTAGG
TATAAGCCATGTCTCCATGTGTCCCAGTCCCTAGCTACAA*CGCTGGCGATATAGTGAGTGGCACAGCCCGAGAAAGTAACCCCTCCCGCCACATGGGCA
CGCTTGGCAACGGGAGCTCTGGGCACACATTATTTTCCCCTCAGGACGCCTGAAAAGCTTGCGCCATCGTCGTCCTCCGACCGATGACCTTAGATGACCA
GTGCGTGGTTTATTATGTGACGAGGTCGATGCCGGTGACGAGGAGCGCGTCGGCGATCACTTGATTGGCCGCCTCCGATGGGTGGACGGCGTCCCAGAAC
ACGTAGGTCGTCGCGTTCGGGCACGTCCCCACCGACTTGGGGTTGCAGAGGAACACCGTGAACTCCACCTTCCCCGTCCCGCAGCATCCCCGCTTCGCCT
CCGTGAACCCTTGATCTCCAGGAGAGGTGACGAGGCTGTACAGGGGCGTGTAGATGTCGAAGACGGCGATCTTGAGGTCGTGGTACCGCTTCGCCAGCGA
GCTGACGGCGGCGCTCATCTTCCCGTTGAACCTCTGGGAGTCGCTGTTGAGCCTCGACACGCACCCGGTGCTCCCGTGCCCGAACAGCGTGATCGCTGCG
GGGAGGCAGCCCaggggcggcagcgtggtcaccgcgatgcgccgcgctcccatgccgtaaagttgcgtcgcgctgttgacgaagatgctgacgagccggt
ccgagaactggtcgacggtctgggtcttgaAGAGCAGagggttgATGTAGTAGTTCtgcacaaagTCACTTGCACCGAAGCTGACGATGTAcaatgagcc
actGATGATGGACTTGGCCTGGCTGCTCCCAGCAAACGCCGTCAGCTTGGACTGGTACTCCCTGAAGTACTCCAATTGTTGGGAGAAAGGGATGGCATGA
TACATAAGTGCCGTGTGATCGTAGTAGCCGGATCCAGCAGACGCGAAGTTGGCGCCGATCAGAAGGTTCTTCCCTGACGCCTGCGGGCTGAGATACgccg
gcGGGTAGctagtaaaccccagggtatcagcagtgatgtcggtggccagcttgccgttgcaaaacctcccggtggccacacggttggggaagtccctgcc
gtagggagggaagtccgccttgatgagggtgtggaggtagtcgttgttacctatgtccaccgacgagtcgccgaaggtaaagacccccggcacgagtggc
tgcgcctccccgccatgagcccccgccaggaggaggacagccaggagcagcaggcacctcacctccattgcagaaccaagacgagtgtgtgc
page-top