Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14746  (registered. 2007)
Contig Information
Length 1626 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 5
Wh_oh Pistil at heading date 3
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_08636 [Oryza sativa Indica Group]
Score 1840
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14746
gaagAAACCTCTCATatcaaaacCCTAAGCAGGTCGGCGGCGGCGGCGCAAGCATCCCCTACTCACCCCAGGCCCAGCCTCTCCCCTCCCATCCTTCCCC
AACATGCTCCCCCAGATGCGCCCCCTCCCTTCCCGCCCAGCCATCCACGCCGTCCACCGGCGCACCTCCCCCGCGCCGCCCTCTATCGGCGGACTTGGGC
AGCATGGCCGAGTGGCCCTCGTGAGGACGACCAAGGCCGTGGTATGCCGCTCCGTCGCCAGCCCGGCAGCGAATCAGGGGGCGCCAGCGGTGGAGAGGCC
TTGGAAGCTTAGCGACGCTCGCCTCGTTCTCGAGGACGGCTCCGTGTGGAATGCTAAATCCTTCGGTGCTTCCGGGACTCAAGTAGGCGAGGTGGTTTTC
AATACCTCATTGACAGGGTACCAGGAGATTTTGACTGATCCTAGCTACGCCGGTCAGTTTGTTTTGATGACCAACCCTCATATTGGGAACACCGGCGTTA
ACTCTGGTGACGAAGAATCCATAAAATGCTTCCTTGGTGGCTTAATCATAAGGAACCTAAGTATATGTACTTCCAACTGGAGGTGCACAGAAACACTTGA
TGAATATTTGAGAAAGAGGAACATTATGGGCATATATGATGTGGACACACGTGCAATAACACGCAGGTTAAGAG*AAGATGGCAGTCTCATTGGTGTTCT
AAGTACCGACCAGTCTCTCAAagACGagggatTGTTGGAAATGGCCAAAAATTGGAAAATTGTTGGTGTTGATTTGATAAGTGATGTTacatgTGATGCT
CCATATGAATGGGTAGACAAGACCGGTTCAGGATGGGAGTTCAACGACAATCAGTCAAGTGAAACTTTTCATGTCgttgtGTATGATTTTGGAgtgaagC
ATAACATTTTGAGACGCCTGGCATCATATGGATGCAAAATAACTGTTGTTCCAGCAAGCTGGCCTGCTTCGGATGTACTTAATTTGAAGCCTGATGGTGT
TCTTTTTAGTAATGGCCCTGGTGACCCAGCTGCAGTTCCATATGCCGTGAAAACAGTACAAGAAATAGTAGGGAAGGTTCCAGTATTTGGTATCTGCATG
GGCCATCAATTGATCGGGCAGGCTCTTGGTGGAAAGACGTTTAAAATGAAATTTGGTCATCACGGAGGAAACCATCCAGTTCGTGACAACAGGACCGGAC
GTGTAGACATCAGTGCACAGAACCATAACTATGCCGTGGATCCTGAATCGCTCCCGGAAGGAGTACAAGTAACACACATCAACCTAAATGACCAGAGCTG
TGCTGGTCTTGTGTTCCCCAAGATGAAGCTTATGTCTCTCCAGTACCATCCGGAGTCCTCCCCAGGGCCCCATGACTCAGACTTGGCGTTTGGTGAATTT
GTGGAGCTGATGAAGAACAACAGATTGTGAGTGGAAGAAAGGTTGGGAAGCTTGGTGAGCATCATGAGTTGCGAAACTTGTACTCAGTTGGGTTTGTTGT
TGGACCGTCGCAGCGAGCTCCGTGGAGTTTGTATTTTAA*TTGTTGATTTCTCTTATCAGC*GaCCAAAACCTATAAAGTAACTAGTG**TATTGTACTa
ttttgtggagtttaaagaataaaatc
page-top