Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig936  (registered. 2012)
Contig Information
Length 1522 bp
Clones alternative view 41 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_yd Spikelet at late flowering 1
Wh_DPA20 Seed DPA20 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 1
Wh_KMP Shoot grown under continuous light 2
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 1
Wh_OKCS Seed DPA5 2
Wh_SHDr Shoot grown with dessication 1
Wh_V483 Shoot grown under cold condition for 3days 2
Wh_VABA Shoot with ABA treatment 1
Wh_VHS Shoot with heat shock treatment 1
Wh_VSCB Liquid cultured tissue 4
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 2
WH_XM Shoots, two-week old seedlings treated with 150-mM NaCl for 24h (22Ž 16L-8D) 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27Ž ) 2
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XT Roots, 18 day old plants were grown hydroponically 3
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_SP 1
WH_XA Root 2
WH_XD Root, treated at 50 microM Al for 6h 1
WH_XE Seedling, infected with leaf rust 1
WH_XF Seedling, infected with leaf rust 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|115473713|ref|NP_001060455.1|| Os07g0645400 [Oryza sativa (japonica cultivar-group)]
Score 902
Evalue 0
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig936
GCAAAACCCCCCTCCACACACACACACCCGCGGCCTCGAAGAGCGCTGGTCCCCTCCTGCACCTGGCCTGGAGCTCGCCCCGTTTCTCCTCCCCACACCA
CACTAGCCTCTCCCTGGTTTTTCCCCAAATCCGACGGACTCGAGGCCAAGCGGAGGCGGAGATGGCGCTGCGGTGGGCGCTGCTCAGATCGGCGGAGATC
TCTCCCGGTCGCAAGGCCGCACTTGAGTACTTGCATTCTCTATCAAAGGCACAGCCTACTCGTTCTATCTCATGTGCCGGCCTGCATCCTGCTGGCAGAT
CATTCAGCACCCAGGCTGCTACTACATCAAGCACACCACAGCCTCCACCACCACCCCCACCTCCAGAGAAGACTCACTTTGGTGACCTTAAAGATGAAGA
TCGTATTTTCACCAACCTCTATGGTCTTCATGACCCTTTTCTGAAAGGTGCAATGAAGAGAGGTGACTGGTATAGAACCAAGGATTTAGTGATTAAAGGG
GCAGACTGGATAGTGAATGAAATGAAGAAATCAGGACTACGAGGGCGTGGAGGTGCAGGTTTTCCTTCTGGCCTCAAATGGTCCTTCATGCCCAAAGTGT
CTGATGGACGTCCTTCTTATCTTGTTGTTAATGCTGATGAGAGTGAACCAGGAACTTGTAAAGACAGGGAAATCATGCGTCATGACCCCCACAAGCTTCT
GGAAGGGTGCCTGATTGCTGGAGTTGGTATGAGGGCATCAGCTGCTTACATCTACATTAGAGGTGAATATGTGAATGAGCGTCTGAACCTTGAGAAAGCT
CGGCAGGAAGCATATGCATCAGGACTTCTTGGTAAAAACGCTTGCGGGTCAGGCTATGATTTTGATGTACATATACATTTTGGTGCCGGTGCCTACATTT
GTGGTGAAGAGACTGCCCTACTGGAGAGTCTTGAAGGCAAGCAGGGTAAACCAAGGCTGAAACCACCTTTCCCTGCCAATGCTGGGCTGTATGGCTGCCC
CACAACTGTCACAAATGTTGAAACTGTTGCTGTGTCTCCAACAATTCTTAGGCGTGGCCCAGAATGGTTTGCGAGTTTTGGACGCAAGAATAACTCGGGA
ACAAAACTTTACTGCATCTCAGGTCATGTGAACAAACCTTGTACCGTTGAGGAGGAAATGAGTATACCTCTGAAGGAATTGATCGAGAAGCACTGCGGAG
GTGTGAGAGGAGGATGGGATAACCTGCTTGCAGTTATCCCTGGCGGTTCATCTGTTCCTCTGTTGCCAAAGCACATATGTGATGACGTGTTGATGGACTA
TGATGCACTAAAGGCTGTACAGTCCGGATTAGGCACTGCAGCAGTTATGGTGATGGACAAATCCACAGATGTAGTTGATGCGATTGCTAGACTGTCATAC
TTCTATAAGCATGAGAGCTGTGGGCAGTGCACGCCTTGCCGTGAGGGTACAGGATGGCTCTGGATGATCATGGAGAGGCTCAAAGTGGGCAATGCAAAGC
TAGAAGAGATCGATATGCTTCA
page-top