Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14741  (registered. 2007)
Contig Information
Length 1659 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_f Spike at flowering date 4
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_002496 [Oryza sativa (japonica cultivar-group)]
Score 905
Evalue 3.3662e-95
Total Hit Count 75
Registered year 2007
Contig Sequence     [ Download ]
>Contig14741
gcccctACCTTAG*CGTCTCCTCGCCGCTACCCTCTTAGGTCTCGGCGCCGCCGCCGACGCCGCCGAGGGTCTCCGGCGGCCACGGACGCGGTTCGCTGT
TACCCCTGACTGTCCGGCACGAATTTGAAGTTGGATATAAGAAATCAACCTAGCGTCTGTCTTGTTCTCTGTGTAGCGCTTTCCTTTGGATTGCAGAGAA
TTTTCAAACAAACCAACAACAACTTGCATCTGACTGACTTGAGGTAACTATGCCAAAGGACAGGAGCTCCCGTTCAGTCTCGCATGAGGGCTGCCGATCT
CGTGTCTCGCCATACAAGTTGCGGAGTGGTTCTCGCAGGTCAGAGGAGGCTGCTGCTGCCGCCGCTGCTGCAGCAGCAAAGCAGGCTGCCGAATGGGAGG
AAGTTCGCTGTCCTGTGTGCATGGATCACCCTCATAATGCTGTTATGCTTGTCTGCTCGTCACATGAGAAAGGCTGCCGCCCTTTCATTTGCGACACAAG
CTACAGACACTCCAATTGCCTTGATCAGTACcgtaaagCCTCCAAGGAGTCCTCTAAGGATTCAGGGGCAGCAGAAtgtgcTGAGTGCCAGCAGCCAGTT
AAActcgcATGTCCATTAtgtcgTGGgccggtcagccattggaccaaggattatgatgcacggaagttcatgaattctaaggatcgagcatgcaccatgg
agtcatgtgagttcaagggtgcatacaaccagttgaggaagcacgctagggaggatcatcctgctgtccgaccaatggaggtggaccccaatcgacagcg
agactggcataggatggagcagcagcgtgatcttggggatttgTTCAGCATGCTGCGTTCGGGGATCAGTGGCAGAGAAGATGGGGTTGGAGTCAGTGAA
GGTGACGA*GGGCGTCAGTGAGAGATCCTTGCACGCCACGTCCATAACGATGGTCTTCATTGTGCGGTCAGGCAGGTCCATCCTACACTACACAGACGGG
GAAATCCccaGGTCGTCGATCAAGAACAATTCTTCTAGTTGGGGAGCCTCGTGGTGAAGCCTCCCGAGGAGGAGGATCAAGCGGCAATGGTGATGCTGAG
GCCACTACTA*CCGACAATGAGGAAACTGACCTGGCAATGTCAACACAGggcATCTGCTGGTTCTCAGGAAGATGCTGGAGAAGCTGATGGCGATCCTGC
GCAGTGATGCTGCCTAAGGTTAGCTCCCTTGCTCTCTTGGACTGAAAAGCCTAGCAGCAAGCCATTTATCGTGGTTTGCCGGGAGTCGGGTGCATATTGG
GAAGAAACATCCGTGCCAGCTTGTCTCAGGTGTAGTCAGGACATTCTGCCTACAAGCAAGCAAGAAGAAATCACGGGGGGAACGTGGTGGAGCTGAGTAG
TGTCGTTTACAT*CCTGCTGGAAT*CTGTCGGCAAACATAAACATTTAATGGTGGCGTTGTATTATTGGAACATGTCCCATGTTTGGTACTCCGGTGAGT
Cgttt*ccctGCGTTGTAATTCTCTCTAGCTCTTCTGCTGAATTCCATTTCGCTgccttgtagtaattgcatctgagtagatcctttctgcatttgaaga
atttgttgtatagcgttcaggtttctagttccacttatgccggaggaacctagaaatcg
page-top