Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14727  (registered. 2007)
Contig Information
Length 464 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_SL Seed DPA30 4
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0405700 [Oryza sativa (japonica cultivar-group)] >gi|113649135|dbj|BAF29647.1| Os12g0405700 [Oryza sativa (japonica cultivar-group)] >gi|218186712|gb|EEC69139.1| hypothetical protein OsI_38066 [Oryza sativa Indica Group]
Score 229
Evalue 8.30588e-18
Total Hit Count 12
Registered year 2007
Contig Sequence     [ Download ]
>Contig14727
ttttttttttgCAAATAAGGCTTTTCCTCGTTCATCATTTTTTTCTCACAAG*ATAAACTACT*CATACAAATG*CATCTTGATGTTTCGTGCAACGCAC
GGG*CATCTTGCTAGTAGGAACTTAAAACACAGTACTAGATACTTGGATAGTTCTCAGAACGACCAAGCAAATGTTCACACCACTCATTTTAACATATAG
GAGTCACATGATTGGCAGCTAGGCCTTGCAGGTACCGGACTGTCCAGGCGACGCTCATTCATTCATTACAGGCTTGTTCTCGTTGGCCTTGAACCTCTGG
TCCTTCGGCTTCTGCTCTTCCATTTTCCTCTTGTCGGAGGACGCGCCGCCCTTCTGGCTGAGGAAGGAGCGGAACAGGGGGGAGTTCACGTCGTAGATCA
TCTTCTTCTTCT*CTGCCGCCGCCGCCGCCGATGTGGAGAGCCTAG*CTAGGGTTCGTGGGAgc
page-top