Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14694  (registered. 2007)
Contig Information
Length 1553 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_07899 [Oryza sativa Indica Group]
Score 1191
Evalue 2.11248e-128
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14694
ctttgtcgtgaatactacaaagtatgCAATTTCACTTGAAG*AAAAATGTGCCATACTACAATTTCACAAGAGCCTTCCCTAAATGCATAATAACAACTA
CATAGCATTTCGCAAAAGAGTAAATGAGGAAAATTCTCACGGTGGATATCCTCCATCCACTTTACTGAATGATATTATTGATGACACCGGCACCGACGGT
CTTGCCACCTTCACGGATGGCAAACCTCATTCCCTGCTCACAAGCCACGGGCTGGATGAGCTCCACAACCAT*CTTGATACGGTCACCCGGCATGCACAT
CTTCGCCTCCTCATCCTTGTCATTCATAATGTTTGTCACATTCCCCGTGACATCAGTAGTCCGCATGTAGAATTGCGGACGGTAACCAGGAAAAAATGGG
GAGTGCCGGCCACCCTCCTCCTTCTTGAGCACATACACAACAGCCTCAAACTTGGTGTGTGGCGTGATGGAACCGGGCTTTGCCAACACCATGCCTCTCT
CAATGTCTTCCTTCTGCATACCACGGAGCAGAAGCCCAACATTGTCCCCAGCAATGGCATCATCCATGGTCTTCTGGAACATCTCAACACCAGTGACC*G
TGGCATTGCGAGTCTCCCTGATGCCGACGAGGTCGACTGGGTCCCCAACCTTGACGGTGCCACGCTCGATACGG*CCAGTGGCAACTGTACCACGACCAG
TGATGG*AGAAGACATCCTCAACAGCGAGCAAGAAGGGTAGGTCGGTCTGCCTCTGCGGGACAGGGATGTGGGTATCCACGGAGTCAATCAAGGAGAAGA
TGCCATCCACCCACTCGTTATCCCCACGCTTGAGGCCAGGGGTGGCCATGAGGGCCTCGAGCGCCCTGAGTGCAGAGCCGGAGACGATTGGCACATTGTC
ACCATCGTACTCATAGGCCGTGAGAAGCTCGCGGACCTCGAGATCGACGAGCTCGAGCAGCTCCTCGccgactccctgttggacagcatcctcttgcgct
tgcgctcgtcaccggcggagccgctgccgctgccgccgtcgatgttgctctcgggactggagctccggcgcgatggcgacgacatggtcggtcgggttct
cgatccaagaaccaggaaaaagatctcttttctttgatggcgggaaggaagaagacaggaaaggggaagaaacggagctggatctaatcaactagaggca
ggatggatgcggcgttgtcgaggggcgaggagttcatgagaagtcgtagaaccagtagaggaaggcgacggagaaggagtgggagcggcagcggacgcgc
agcttcatcgggggacggcggccgtcagaggaaggggaaggtaaacatgggtggtgcggggaggctctctagatcggatctgcgacgaactcctcctaag
accaaggagtcgaggctagaatgtgacagagctcagggccttatttgcaacggaacggggagtacactgtaaggaaaaaagaagctacagggactgaaac
gtaagaacgggaagggagaaagaaagcaggacttagctgcaaatcgaaggcac
page-top