Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14693  (registered. 2007)
Contig Information
Length 819 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 13
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit stress-inducible membrane pore protein [Bromus inermis]
Score 618
Evalue 2.2306e-62
Total Hit Count 49
Registered year 2007
Contig Sequence     [ Download ]
>Contig14693
ttttttttttcTCAAACTCGTGAGCATAGTGCCACGAATAGAACATATAGAACAAAAGGAGCAAACATTACAGCAGAAATTCTAACGAAATTCGGACTTG
CTTGGTTCCAGGGCTAGCTAGCAGATGGGACAGAGTGCACAAACTGTCAAAGGTACATGGAGAAATTAAGGGAAATACAGTACCACATTTCAAGAGTTGC
TCCAAATTTCATAGCCCTAGCCCCACGTTCCGCCGCTTAGAATATGC*CGGAGAGCATGGTCGCCGCGCTCGACAGTGCGGCTCCGGTGATGGCGAAATG
GACGACGTGGTCGGAGTGCCCGTTGT*CCCCGGTCAGCGCGACTGCCGCTCCCGCAATCGCCCCTGCTATCGCGCTGTTCTTCCAGTCATGGTGTCCTCT
TGCCTCTCTCAGACCGTACGTTATCCCAGAGTAGACTCCGGCTGCCAATCCCCACTGGATGGCCTCCTTGCTTGCCGATTTAACCACTGCGTCGAGCGAC
TTCTGGCCGTCATCCCCTCTGGCGCTGGAGAAATGGCTCCTCTTGGCGGTGCTGTCCAGCCCCGTCGAGTCTCCCCACATCCCTTCGACTGCGACGAAGT
AGGCCTCCCGCGA*CACCGCCCTCGCCGCTCCGACTCCGGCGGCGCGGATGAAGCTGTCGGCGACGCGGTTGAGGAGCGGGTGGCCGAGGTCGAGGAGCG
GGCGGCGGTCCATGCTCGCCACCTCGTCCTTGAGCGTGTGCGCGTCAAGCCTGCTGCCCatctcctcctcgcagctggtcttctctcttctctttgctcg
cttgctgtggactgcgtgc
page-top