Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14691  (registered. 2007)
Contig Information
Length 1246 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 3
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit alpha-soluble NSF attachment protein [Zea mays]
Score 1340
Evalue 8.32654e-146
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14691
ttcggcacgagggtttccgatccccttcctcctctcccttcgttttctgctcctcccccgcaacAAATCTTGGTCGCTTCGCCGCCGGCACAAGCGATCG
GAGCAGCGGCCCGTCGGCAGCGATGGGGGACCACGAGGCTCGCGGTGACGACACGGAGAGGAAGGCGGATAAGAAGCTCTCCGGCTGGGGGCTCTTCGGC
TCCAAGTAC*GAGGACGCCGCCGACCTATACGATAAGGCCGCCAACTTTTTCAAGCTCTCGAAGAACTGGAACAGAGCTGCATCTGTGTATATCAAGATT
GCTAATTGCCATATGAAGGGTGATAGTAAGCATGAAGCTGCCTCAGCTTATGTGGAAGCTGCAAACTGCTACAAAAAATTCTCACCTCAGGAAGCTGCGC
AAGCGCTAGACCAGGCTGTTAATCTTTTTCTGGAAATTGGTAGATTGAGCATGGCTGCAAGATACTGCAAGGACATTGGTGAGATTTATCAGCAAGAACA
AGATTTGGAGAAGGCTTCAGATTACCTAGAAAGGGCCGCTGATCTTTTCGACAGTGAAGGACAGACATCTC*AATCAAACACC*ATT*AAGCAGAAAGTT
GCAGAAATTGCTGCGCAGTTGGAACAGTACCCAAA*GGCAACTGAGATTTTTGAAGAAATTGCTCGTCAATCAATTAACAACAATCTGCTGAAGTATAGT
GTCAGAGGCATCCTCCTTAATGCAGGGATCTGCCAACTATGTAGAGCTGATGCTGTTGCTATACAAAATTCATTGGAGAGATACCAGGAAATCGATCCGA
CTTTCTCAGGAACTCGTGAATACAAACTTTTAGCTGATCTTGCTGCATCAATGGACGACGGAGATGTTGCCAAATTTACTGATGCCATCAAGGAATTTGA
CGGCATGACACGCCTGGATCCTTGGAAAACGACACTGCTGCTGAGGGCAAAGAATGAGCTGAAGAAACAAGAGGATGATGAGGATGATCTAACCTAAGCC
TTATTGTAAAAACTCTTTGATGCTTCAACATGGTGTGATTTATGCCTCTATTTCGTCTTGGAGGTACATATAATGGGCATAATGAAGATCCACCTTTTGG
TTGTATAGAACTTCATTTTGAAGTACCATATCGGGTGTCGTGTGTCATTTGTTCTTGTCATGACTTGGTTTTCCGTCCGAATGAAAATACCATAGCACGC
TGTTGCtggtaTCCTTCTGTAACATGTTCTATTtcaccctCATtaa
page-top