Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14655  (registered. 2007)
Contig Information
Length 902 bp
Clones 13 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 3
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit RecName: Full=Xylose isomerase >gi|1296809|emb|CAA64545.1| xylose isomerase [Hordeum vulgare subsp. vulgare]
Score 1188
Evalue 2.1186e-128
Total Hit Count 348
Registered year 2007
Contig Sequence     [ Download ]
>Contig14655
ttttttttTTGGCGAAC*A*GTTTAATTCTGATACAATGTTACATTATTTTCAGCTCCACGCAGTTTGTTTACAGGGTTCATTGCATGGAGGCCTAACTA
TAGAACATCGCCCGTAGTGGCGAGGG*GACTGGGCGTTCGAGGGTGTGCTCTTGCTTTT*ATTCCTAGAACCGTGGGCCGTCATCTACAGAGCGGATTGG
AACAGCATCTCAGCCAGTTCCTGTTTGCCGGATGGAACGGTTGGCTCGCCCCACTCCAAGACCTTCTTTTCTAGCGTTTCAAAGTCTCCCTTCCCAGCCT
CGATCATGGCACCAAT*CTCAGTGTCAAAGCTCTGGTAGCGCTTGCGTACAAGTTCATCCAGGGAACCATCCTCAATCAGCTTGGCAACATTGCGGAGGC
CACGGGCCATGGTGTCCATCCCAGAGATATGGGCAATAAACAGGTCCTCAACATCA*GTACTCTCTCTCCGCAATTTGGCGTCGAAGTTGAAGCCACCAG
GTGCAAGTCCATCATTCTTAACCACACTTGACATAATCAAAGTAGCTTCTGAAATGTCTGTAAGGAACTCATCCGTGTCCCAACCAACTTGTGGGTCACC
AGTGTTTGCATCAATGTTCCCAAGAATATCATTAATGCGAGCAGTCTCAAGCTCATGATGGCAGCTATGCCCAGAGAGAGTAGCATGG*TTGCACTCGAC
ATTTATCTTGAATTCTCCTGTAAGACCAAACTTCTGTAGGAAAGAGAA*TGTGGTTGCAACATCCCAGTCATACTGATGCTTtgttggttcttgtggttt
aggctctatcaacaatgttccgttaaagccaatcttcttcttgtggttaacagcagcttgaagaaagttagccaaatgttcaagttctccctcgtgccga
at
page-top