Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14646  (registered. 2007)
Contig Information
Length 1059 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 3
Wh_e Seed DPA10 2
Wh_r Root 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ES43 [Hordeum vulgare]
Score 1076
Evalue 2.65833e-115
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14646
ttttttttttgaagaaagggcatttaagctcactcaCAAATGTCCATGTCAACACGAAGGGGG*AAGGAAAAAAGAAGAGAG*AAAAATTACTCCCTCTA
ACAGGTAGGTCCACATGG*ATATGCAAAGTCGCAAACTGGCCGAATGCCAG*ACTCTAGAAGAGACTCTCAATACAGGTTCGTTCTACATCAAACTGGAA
ACAGCAATGTACATCCACCGCGTCACATGCGTGAAGAGATGGAGGACTTCCGCCCAG*ATCGCCTTCGCCTTCACCGCCGTCGCCGCTTCGACTGCACCT
GCTTCTCATCTGATTCGCCTGTAGATTCATGCGAATTTTCATTCTTGACTCCATTTCCATTTCCATTTCCATTTTCAGCAACACAACCTTCGCATGTAAA
ATTCTCAAGTTTCTTTGCTTCTTTGATTGTCTTTCCAATACAAGCAGGGTGAAACCAATCAGAGCATTCCTCACACTGGATCATAAGATCGTCAGGGTTG
TATGGCATCTCACACTTACAAAACACAGCAATGCGATCAGGCACAAAGCTGCCTGTGATTGACTTGTACTCGAAGCGGCAAAAATAGTCCTCAGGATTGA
CAGCAGAAAGCTTGGTGTAGTCCCGGAAGCTGTAGACGTTGCACTTGCACTCTATGGTGTCAGCACTCTGCACATCTTGGTGGTCAGAGAGGAACACCTC
CTTTTCGCCATGGAATGGCCTGCGCCCACCAATGGACTCCTCCGGTCGGTAGTACCAGCGCACTTTAACCTTGACATTTGCGCCCCGAGGTCCTGCTGCC
TCGATTTCCTCAATCTTGGCCACATACGGAGGCTTTGATGTGTCGGGCGCCTTCATCAGCACAGAGTCCCCAGGGCGGATGACGCCGTCGGATCCCTTGA
TGGTGTAGGACTCCAGGATCCGCCTGGGCGTCCGCGGCGTCTTCCCCGGCGTCTTTGACATGGGCGGCGGCGGCGGATTGGGAGGCGGCGGCGGCGCAGC
TCCGACGAGGGGAGGGGGTGGGGGGATGGGAA*TGGGAATGAGCGAGctctctctctcc
page-top