Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14640  (registered. 2007)
Contig Information
Length 779 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_r Root 7
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ubiquinol-cytochrome c reductase complex 14 kDa protein [Zea mays]
Score 449
Evalue 8.08415e-43
Total Hit Count 126
Registered year 2007
Contig Sequence     [ Download ]
>Contig14640
agctctgtagaaatgggaagcgtaaacccgaagcaaacaacaaaacagttgctcaacggaaaagtcccaagagcagagagttgttcagacttctacagca
acaattcCGTCAACCAAAATAAACTTTTATATCAGCAACAGCAACAGAAATTCTGTCGCAATTAATTTGGGAATGGGCACGAGAAACTGCTACAGGCAAT
GGACATGAAACCGGAAGTAGGAATAGTGTCATAATCTGCATTTTATTTCATGCATTATGATGCTACGAGGAGCAAAAATTGTGGCGCATATCATGAAAAG
AA*GTCTTCAAGGAAGGGTTCTCTCGTAGAGGGGAAGGGCTCCCAGTGCTTTACGCTCTGCTGCCTCCTTTTTCACCAGAGCCAGCATGTCGCTCAAATA
GCTTTTGAATGGTGTCTGCAGTGCCCGGACGTCGTCGGGGAGGTACTGGTGCTTCATGGAGAGGTCCATGGCGCGCTTGAGGCGCTGGTGGCGGGCGTCG
ACCACCTCCCGGGGCAGCCTGCCGAGCGCCTCCTTGATGTCCAGATCGAAGTAGGGGTCGTACAGATCGTCGTACCTCAGGCC*GAAGTTCTTGAGGCGG
TTGGAGATGGTGAGCATGTGGATGCGGGCCAGCGGGTTGCGGCGCGGGTTCACGAACCACGACGAGAACGCGGACAGCAT*CGACGTCAT*CCTGGGCGG
CGGCGGCGGCGGCGGCGGCGATCCCCTTTCGTCTCCTCTCTTCTT*cgGCGTTTGTGATTTGGGGaggggaggaggagc
page-top