Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14637  (registered. 2007)
Contig Information
Length 1039 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_r Root 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein LOC100191938 [Zea mays] >gi|195657747|gb|ACG48341.1| DREPP4 protein [Zea mays]
Score 349
Evalue 1.05684e-31
Total Hit Count 24
Registered year 2007
Contig Sequence     [ Download ]
>Contig14637
ggaactacgcatccatcccttccgcccccagctacctcgcttgctccacgcatcgtctttgaaggagaggaagatgacgagcgTATGGAAGACCAAGGTT
CTCCCCGGGCTCAACAAGATCTTCGACAAGG*ATGGCAAGAAGGCCGCCTCCGCCGAGTTCTTGAAATCCTTCAACAAGGAGGAGATTGACAAGGAGATT
GAGGACAAGAAGACAGAACTAGAGCCCAAGGTTGTGGAGACCATTGAAGCATCTCCTCCAGAAATTAAGGGCTTGATAAAGGATAAGAAAACATCCAAGA
TCAAGAAGAACTCAGTTGCCGTCACCAAGTTCCTTGACGATTTGGCCAAGATTGATTTCCCCGGAGCCAAGCTGGTGAGCGACGCGGTGGCCAAGTCCGG
CACCACGGCCCCTCTCCCCGGCCATCGTCTTCATCTTGGACAAGGTTGCGCCCTTCGTCCCAGCGCCCAAAGAGGAGCCCAAGGCCGAGCCCGAGGACGC
CGCCCCGGCAGAGGAGACCACCACCC*GCGAGGTCGCCGTGGAGGAGAAGAAGGAGGAAGCCGAGCCCTCCGCCGCACCGGCAGAAGCGGCCGCGCCGGT
GGAGGCAGCCGCGCCCGCTGCTGAGGTAGTGGAGGAGAAGAAAGAGGAGGAGAAACCCGCGGAAGCCGCCGCACCTGCCGCCGAGGAGCCAGAGAAGAAG
TGATCGGTCGCCGCCGGCCGGAGTCCAAGAGCAACCCAAGCTACCACCTAGCTTGCTGCTGGTAATGAAAACATTTTAAGTTATTGTGAATTTGTGGTCG
CTCTCTGTGTCAAGGTAGCTGCACAAAAGTAAGCACGTACGTACGTACACTGCACTTGCCATGCATACCACGCATGCAAACGTACACGCATGGAACATTT
GTTATTCTTTCGATGGACCGGTCTCCTCACCGTATGTGTACATTTTACGTGGGGCTTTCTTGCTTTTTTGtggtggtTAAAACCTGTGTAATtatgatta
tattggtgtgttaatttgttggtcatggtaaaaaaaaaa
page-top