Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14593  (registered. 2007)
Contig Information
Length 1255 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit U2AF small subunit [Triticum aestivum]
Score 915
Evalue 1.21829e-121
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14593
ttttttttttgagcaaaggaacattcagggaacacactataataatcataacaataacaagTCCAacaCCAAATATGTTCCATCAACAAATCCATAGAGG
AAGTTCAACAAG*AACAACACTGAAGATGTTACATCAGGCATCCAAGCAAGTTCACTAGGACCAAATTCTAACTCCATCTACCATTACACGATCAGACAA
GCAAGCAGAACATCCGGTGAACAAGGCAACACTTCAACCTGCAGTCAGACAGGAGATCTCACGCCTGAGCAGTCTCCCTCTCACGGTTCCACTGATCGAT
CTTCGCCCTCCTCTCTTCGCTGCCCTGCCTGGCAGGCGCCTCCCTTTCACGGTTCCACTGCTCAATCTTCGCCCTCCTCTCCTCGCTGCCCTCCCTGACG
GGGCTCCTAGTCCTGGACCTGTGTCGCCGGCgcagCCTGCTCCCATCGCTGTCATAGTTGCGGTTCCTCTCGCTGCTCCTCCGGCTATGGTGGTAGTAGT
CGCCGTAGTCACCACGGTCCAGGCTGCCTCCATAGTAGTCgcccgcGGTCCCTAGACCGTGAGGAGCGATCACGGTCCCTGGCATGGTGACGGTAGGGGC
TCGGGCTCCGGCTGCTCCTGCTGTGGCTCCTCCTGGACCTATGCAGGTGCCCATACAGCCTCTTCCTCAGGTCCCTGCCAATCTCCTTGACATGCATGAA
GTTGCAGTACCCTCCACGGTTGCAGTTGTGCTCCTCGAACTGCCGGCAGGTGGCCTCCCGGAAGTCGGTGACGGGCGAGAACTCAGCAATGATGGGGCGG
CCCGAGTAGAACCTCCCCTGCAGCGCCTGGAGGGCCTTGGCGGCCTGGTCCTCCTCCCTGAACTGCACGTACACGTTGCCAATCAGGTGGTCGGCGAGGT
TGTCGCAGACGTGCAGGTTCTCGACCTCGCCGTGCTTGCTGAGCTCGTCGAAGATGTCCTCGTAGAAGTCCTCGAAGTCGCCCTGGATCTTGACGGGGTC
GATGGGGTTGCCCTGCGCGTCCACGCCCGGGGTGATCATGTCGGGGCGCTGGTACATGTTGCAGAGCAGCAGCGTGGGCGAGACGGACGGCTTGTTGTGC
AGGCGGGAGCAGCGGTCGCCGTGCCGGCACGCGCCGATCTTGAAGTAGAACGGGCAGTTCACGCGGTCCTTCTCCGTGCCGAAGATCGACGCGAGGTGCT
CGGCCATGGCGGCGCACCCTGGATTCGCAAGCTAGAGatctctgcactcccaccc
page-top