Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14585  (registered. 2007)
Contig Information
Length 675 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 3
Wh_oh Pistil at heading date 3
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit qLTG-3-1 [Oryza sativa Japonica Group]
Score 423
Evalue 6.16591e-40
Total Hit Count 295
Registered year 2007
Contig Sequence     [ Download ]
>Contig14585
aggaattcggcacgaggcgggaggagGCGGATCAGG*CGGGCGCGCGCGGTGCCCCATCGACACGCTGAAGCTGGGGGTGTGCGCCAACGTGCTCAACGG
GC*TGATCAACCTGCAGCTGGGGACGCCG*CCGAAGCAGCCGTGCTGCTCGCTAATCCAGGGGCTCGCCGACCTGGAGGCGGCGGTGTGCCTCTGCACGG
CGCTCAAGGCCAACATCCTGGGCATCAACCTCAACGTGCCCATCGACCTCAGCCTCCTCGTCAACTACTGCGGCAAGAACGTCCCCTCCGGCTTCCAGTG
CCCCCGCTAGAAGAGAAGACCCGAGAGATCCATCGTCCACTGCATGCAGGCATCCACTATAC*GTAC*GTACGTGCATGCACGCACGCATGATCTACAAT
CCATCCATTGACTAGTGCTCTATAGC*TAGTCGTATACGTTATTTGCTTCATAATTTATCATCGCTCTTGCTAGTTGCTAAACTTGCATATTTCTCTCTG
TGTGTGTGGTAGTACC*GTTTGTACCACGTACTGCTTGTCATCGAACTGGTTACGGTACTCTATGGACCATGGATCCAGTTCTCAGCCACATATGATCTC
ATGCGTGTACCGCTGGCTGCTATTATATTTCCTTCAAAAAGAggttgctcctccacaattgtagtaaagtaatta
page-top