Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14563  (registered. 2007)
Contig Information
Length 1281 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_SL Seed DPA30 7
Wh_e Seed DPA10 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os04g0665700 [Oryza sativa (japonica cultivar-group)] >gi|75232918|sp|Q7XPK1|C3H31_ORYSJ RecName: Full=Zinc finger CCCH domain-containing protein 31; Short=OsC3H31 >gi|32488659|emb|CAE03586.1| OSJNBa0087O24.9 [Oryza sativa (japonica cultivar-group)] >gi|113565750|dbj|BAF16093.1| Os04g0665700 [Oryza sativa (japonica cultivar-group)] >gi|116308845|emb|CAH65982.1| H1005F08.11 [Oryza sativa (indica cultivar-group)] >gi|215768501|dbj|BAH00730.1| unnamed protein product [Oryza sativa Japonica Group] >gi|218195775|gb|EEC78202.1| hypothetical protein OsI_17823 [Oryza sativa Indica Group]
Score 1080
Evalue 1.20087e-115
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14563
aggaatcagtgacccatctgctgtcaacacaactggataatcaccaaggactgtgaagcagccgccaaataaaaatgcaaggagaaaactcgaaaggtga
ctaactacaCTGGGATGACAGCAag*aaagTTCTGAAGCGTATTT*atTCAAAAAAGCTGAATCTAAATCACAATCCATAGAACCAAAATACAACAGGCC
TAATCACCTAGAGCCAACAGCAAGGGAGAACAGAATAGTCACAGTAGCAGCACAAGGAGGAGTGAGGATCCACCGCAGCAGCGGTGTCATCAGACGGCAG
CACCCTTCCGCTGCTCGGTCTCGCCGTGGGCGAAGTGGCAGCGCTCGCCGAACGTGCAGGTGCCCTTGAGGAAGTTCTCGCATATCTTGGTCTTGTAGTT
GCTCCTGCCTCCAGG****CC**CACCGCC***GCCGCCGCCTCGGACTGCGGGAGCCGCTGCGCCTGCAGGGTTCTTCGACGGCGTGCTGGCGCTGATG
CTGGCAATGAGATCACGCACCATGTCGTTGGCTTGCTTTATCTGGTCAAAACTGCCTTCCAGCTCAATGTTCTTCAGGTCTGGGTTTGATTCGTGGTCGC
GTATCGAGAGCTTGACCCCCGTGATGCGGCAGATCTGCTT*CGTGTTGACCCCACCCTTCCCGATGATGCCTCCGGCGAGAGCAGCATCAACACTGACCT
TGCAGGTGGACGAGGCGCCAAAGTTTCCAGCTGGAGGGCCCATCGAAGCTGGCGGAGGTGGTTCGTGCCGACCTCCATATCGACCACCCATAGGAGGAGC
ATAGGAACTTTCCTGGGACATGTAGGAGGATGGTGCCCTGCCAAGCTCCCTCTCGCCATGGGCGAAATGGCACTTGTCACCAAACTTGCAGCCTTCTGCA
GTGTTGTACTTGGTGCACATGCGTGTTTTGACACCAGAAGCAGCATGATCCGCAGGAGCTCTTGACGGTGCAGACACAGCAGCATGGCCTAGGCTGTGTG
ATTTTGATACTGCCTGGTATCCACCAGGGACAAAGTGCGCAAAGTGACATCCCTCACCAAAGGGGCACCCAACAGTGCTGAAAAACTTGGTGCAAGGCTT
CGATTTGCTTGATAGACCAGTTTGTTGTGACTCCGATTCTCTCGAGCGCTTCCCGCCTGCGGCGCCTCCGTTGGCGGACTCCGGCCGGGATCTCTTGCGG
GCGGCGGCATCCATGGCGAGCCCTCCGCGTCGAGGCGGAAACCCTAGCTTGCGGTTTGGCGGAGGCGGAGTGGGgcgcagc
page-top