Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14547  (registered. 2007)
Contig Information
Length 1005 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_dL Crown of seedling 2
Wh_f Spike at flowering date 3
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 60S ribosomal protein L10-3 [Zea mays] >gi|195623196|gb|ACG33428.1| 60S ribosomal protein L10-3 [Zea mays] >gi|195647410|gb|ACG43173.1| 60S ribosomal protein L10-3 [Zea mays] >gi|195658101|gb|ACG48518.1| 60S ribosomal protein L10-3 [Zea mays]
Score 1055
Evalue 6.76423e-113
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14547
ttttttttTTGAGCATAGGCAACAGTTATACATCATTCATGGATGATCCAGAAAATTCTCCAGCACTTGTAGATAACAATCTCAAGAAAGTGCTAAAACA
GGACAACTGCAGATATGTAAACCTCCACCATGAGAAACGGTCTACAGTAAAGAACTACAGAAGTAGATTATACTGCAGCCAGCAGCCAGCTTTACTTAAC
ACTCGTTCAAGCATGGGGAAT*TATACTAGCTAAAGCAAAAACAGAACTCATGAGTTCCATCTAGTGAAGGAAATGGTCTGTGCATGCTTCAACTGCCTC
AAGCCAGGATCGCCTGCCCAGGGGCACGTTTAGCAATGGGGCCATGGACACCAAGCAACTTAGCATTGACACCATCAGGCACGATTCTTCCCTCACTCTT
GTACTTGATGTAATCGGCCTTGTTGAACTTGGTAAAGCCCCACTTCCTGCTGCGAATGATCTTTTGACGGCCTGGGAACTTGAACTTGGCACGGCGGAGG
GCTTCATCAGCATGAACAGCATTGCTCTCCTTGCAGCGCACAGATAGTAGAACTTGGCCAATGTCCACACGAGCACAGGTACCCAGAGGCTTCCCAAAAG
CACCCCTCATTCCAGTCTGGAGCCTATCAGCCCCAGCACATGAAAGCATCTTGTTGATGCGAAGGACATGGTATGTATGGACCCTGACCCTCAGGTGGAA
CGCATCCTTTCCAGCATTCTTCGTCATGTACTTGTTGCAAGCAATACGGGCAGCCTCAAGAGCCTCGCTGGAGACATTCTCCTTTTCCCAGCTGACCAGG
TGGACGCAGGAGGGGAACTCATCCACTCCCTTCTTCTTCATCCCAACATCATAGATCCTGATCTTCGGGTCAGGTACACCACGACAGTACCTTGACTTGG
GGTATGGCTTGTTTTTTATCTGGCGATAGCACCTAGCAGGTCGTCTCCCCATGGCGAAGGCGGTGGCGACGCGACGGAGGAAGAGGAGAGGAGGCGAcgg
cctcg
page-top