Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14520  (registered. 2007)
Contig Information
Length 1047 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 6
Wh_SL Seed DPA30 4
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit OSJNBa0068L06.9 [Oryza sativa (japonica cultivar-group)] >gi|116317777|emb|CAH65755.1| OSIGBa0123D13.4 [Oryza sativa (indica cultivar-group)] >gi|125546927|gb|EAY92749.1| hypothetical protein OsI_14504 [Oryza sativa Indica Group] >gi|125589074|gb|EAZ29424.1| hypothetical protein OsJ_012907 [Oryza sativa (japonica cultivar-group)] >gi|215697911|dbj|BAG92153.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215737534|dbj|BAG96664.1| unnamed protein product [Oryza sativa Japonica Group]
Score 928
Evalue 3.80241e-98
Total Hit Count 217
Registered year 2007
Contig Sequence     [ Download ]
>Contig14520
aacatGTGTGCTTATTTCTTATGATGAGATATTATTGACTTCACCACATCACAAGCGAACATCGAATAACAATCATCCACGTGCAGTTTCTACTTGAAGC
GACAAATTTTAAAAAATCCGCGCAAGGGAAATGATACACCACAGGATGTCATTATCTACATTTTATTGTTCTTCACCATCTCTTCCACGTCGAGCTCTAC
CGCCAAAACCGGCGAATCCTGGAACATGGCTACACGG*CTGTTGTCCACTGGGCCATGATCAACAGCAGTTCTTAAAGAGTATATAACTCTGCCAACAAT
ATCAGTCATAGGGACCGGCCCAAATAGGCGGCTGTCCCTAGCTTCCTTTGCCTTTAGTTCTTGGTTATCT*GCCATGACCCAGCATTCGTCCTTGTCAAG
TACAAAGGGCTCATCCTTCTCATCAGTAGAGACCATCTCATAGCCTTGCACTGCAGCCAGTCGTCGGACAATTAAATCATCGGATTTCTCTGGGTCCTTC
AACAAGACGATGTCCCCAACAAAGAGTTCTTTTGGGGACAAAGTGGCGAGCTTTCTGACGAGGACGGTTCCTCCGGTCGGAGCCACGACAGGGGCCATGG
CTTCGCCCCCTTTGATCCACTGCGGGAAGGTGAGCTTGCCCTGGAAGAAGCTCTTCCATATGGCGTCAGTCATCTCAGTGCTGTTGATCTGCCCGACGGT
GTACTTCTTCCAGGAGAGGGAGATGGAGTACTCGAACTTGTGGGCGGCGTAGCGGAACCACGTCGACAGCGAAACCATCCTGCTCCTCCTCGCCCTCTGC
AGTGCtgcCGCTCGAGGACCTCGCTCTTCCTCCCCCGCCCGCTGTCCTGATCCCCTCTCTCCCGCTCGATTGGGGCGGCGGCTACCGTCGCTGCTCCCGG
CAAGAAATACTGGAGCGCGGAGGGGGGAGGGAGGGGGGCTGCCTCGCGGACGGAGGCCGGAGGGGGAGGTGGCGGCGACGGCGAAGATAGTGGGGGAGAG
AGGGGATGCGacgaggtgggggcggggtagctaggcctcgtgccgaa
page-top