Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14509  (registered. 2007)
Contig Information
Length 794 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_oh Pistil at heading date 9
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsI_17477 [Oryza sativa Indica Group]
Score 757
Evalue 1.63379e-78
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14509
atgtagtaaaattacagtgttccatcacacatacTACaccaccaACTCTGCCCTACAAAGATGGTCACGTAGGCCGTAGCTCATAGCGCCTTACCAAACA
CAAACCCCCACATCACGCTGACAGTATACATACCAGACGCCCACAATTTTTTATTAACCCAACAGTAAGTTTATTCTGCAAACCATAGGGTCACACGGCC
ACACGCCTCATGCCACGAGGAAGAGCAAGGATAGATTGCTCCCACGCTGCCTTCCCCGAGCAATCACTGGAATGAATGGCCGGCAAACCCGACGTGACAA
TAGATAGATAGTTTAGGGGCGCGACTGTTTACAGCCGGGAGATGAGCAGCGGGACGGAGACGGTGGCCGTTTGCTCGGCCATCGGGTGGCACATCTCCAG
CATGTCCAGCTCCCTGAACTTCTCCAGGACCCTCATCCGGCACTCCTCGGCCGCCATCTCCCCCGTGGAGAAGGCGCCGTGCACCGTGCCCGTGTACTGG
ACGCTTGTGGCCTCCCCGGCAAAGAATAGGTTGTCGACGGGGATGCGGAGCTTCTCGTACAGGTCGCGCGGCTTGCCTACCCCGTCAAAGGTGTAGGAAC
CAAGCGTGTTCTCGTCTGAGCCCCAGTGTGACACCAGGTAGTTAAGCGGCTCAGCTGCATTAGGGAGGATCTTCTTCAACTGGGAAAAGGCAAATTGAGC
AGCAGCCTCATCCGACatcttttcaatgtcacaagcaagccggcctgcaggcatgtaaacaagaacagcatgccctgttgccttgtgaaggttg
page-top