Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14495  (registered. 2007)
Contig Information
Length 644 bp
Clones 12 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 3
Wh_oh Pistil at heading date 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GF25205 [Drosophila ananassae] >gi|190623715|gb|EDV39239.1| GF25205 [Drosophila ananassae]
Score 77
Evalue 7.47315
Total Hit Count 2
Registered year 2007
Contig Sequence     [ Download ]
>Contig14495
gcCGCCGTCGTCTTCCTCTTCGTCGTCCTCG*AAGCCATCTTCTGGTCTGTTGGTAGCTATGGCGCTGCGCACCGTTGCCGCGAAGCTGAAGGCCCCCGT
CGCCTCTCTCAAGCAGGCCTGGGCGGTCTGCCGTCCTCAGGCTAAGCACCCTTTGGAGGGCCTGAATGTTGATCCGCTCACCCTCCAGGAGATGAAGGCC
CTCGAGAGGGCCGTTAGGGCAGGCGAAATGAAGCAGACTTTGGTTACCATTGGCTTCATGGGTGGTTTGACTGGTGCGGTTGCCCATTTGCTCCATTCAG
ACTTAGCTGCCCGTGAGGCGACGGCGGAGGCGGAGGCGGAGGCGGCGGTACGTGAGGTGCTTGATTCGCTTGATTCAGATGTCAATGCGGTTGGTACAAA
CAAAGACTAAGGCGCCCAAGGAAATGGCGTTTGGTTAGCCTCGCTGTTATGTGCGTTAATTTTAAGCTGGTGCGGATGTCTTATATGTTTAACTACTCGG
TATTTGGCTTGTGGCAAGAGTACTATTTATGACTGGGTAGTCTGTGGATTCATCCGAGTAATCTCTGATAATATTGAGGTTTCATCTGTGTAATATGTTA
TCTAAGCAAAGGGTCAAGCGTTTTGtcattttacaaaaaaaaaa
page-top