Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14448  (registered. 2007)
Contig Information
Length 916 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_dL Crown of seedling 1
Wh_f Spike at flowering date 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 2
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Cu/Zn superoxide dismutase [Triticum aestivum]
Score 796
Evalue 6.18745e-83
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14448
aaatataattctttgagcattttatagcTTACGCACACcaaaattcccgagttcACGCTTCatagcTCAAcaag*acgaaagTGTGCAAACATTTATTTG
ATAAACCCAACTTTACACTGATACAAACGATCAACAGAAACTATTAAGCATCCGATATTTGAAATCCAGGTAAAACGAGAATGGCGTCGTTACAAGTATG
ACTGGAG*ATGCAAAACCAGAGATGGAAACCAGTATGACTGGAGATGCAAAACCAGAGATGGAAACCAGCGACCTACAACGGGGTCAGGCCAACAACACC
ACATGCAAGTCTTCCACCAGCATTTCCAGTACTGAGGCTGAGCTCATGCCCACCTTTTCCCAAGTCATCTTCAAGCTCATGAACAACAAACGCTCTCCCA
ACAACTGCATTAGGGCCAGTCAAAGGAATCTGGCTATCGACAATGGTTGTCTCCGCCACACCTTCAGCATTGGCAACAATGTTTCCCAGGTCACCCGCAT
GACGGACTTCATCTTCTGGTGCACCATGTGTCAGGCCGTTTGGGTTAAAATGTGGACCTGTTGATATGCATCCATTAGTC*GTGTCACCAAACTCATGGA
GGTGGAAGCCATGAAGTCCAGGAGCAAGTCCAGTGATAC*GAACGTTCACC*GTCGTAGGACC*GTCGTCTTCCTGGGTGAGCGTGACGACGCCCTCGAC
CTGCGAGGTGCCCTTGAGCACCGCGACTGCCTTCTTGGTGGCGTCGGCGA*CGACGAGCGCCCTGGCGGCGGCGGTGGCGCCTTCTGGGGTGCAGACAAT
TCGGAGCGACTGGAAAGGGCGGGCAGAGGCAGGAGCCTGGAAGAGAGGCGCGGCGGCGGCAAAGAGGAGGCTCTGAGCGGCcatggcGGTCGtcgggagc
ggaagaactttcctcg
page-top