Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14445  (registered. 2007)
Contig Information
Length 936 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 2
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit GI10943 [Drosophila mojavensis] >gi|193906829|gb|EDW05696.1| GI10943 [Drosophila mojavensis]
Score 87
Evalue 1.06518
Total Hit Count 7
Registered year 2007
Contig Sequence     [ Download ]
>Contig14445
agacttgaaattggtgaaacctggagaGCTTAAATTAgtntcCTATGAACTGACATTCAacCAATTCTCAACACGCCAACAGCCATGATCCAGTAATAGA
AACGATGTGATGATAGGCACAGAGCAATGCAAGCATGAATCACACTTCAGAACCCACACGTTCGCATACATCTGAGATGTTCATACCTACACCCGTACTG
ACAATCTCACAGCTCCAAGTTTAAATTAGTCGTCGTCAGTCAAACTGCAGACATGCTTAAAATAGGGTGAAAGCCCCTAGAACCATGATAGCCGACTTGG
ATGACAATGCGGTGAAGAAATGAAAGGGGCAGGGTGCTCCAGGCGATCATCTCTTAGCATGCAACATCCCCTCCATTGTCCACAGCAGGCTCGTGGTGAG
AAGCCGAAGCCGAAGCCGAAGCCGAAGCCGAAGAAGCGGGAGGGGGAGCCAAGGGTTCGGGGAACTCCAGTGGGATTTCTTGGCTGAACAGGCTGAGGTG
GTTGTCGAAGGCGGGGACGGGGCCGACGCTGGCCTCGTACTCGGCGATGGTGGCGGTGGCGAAGTCGTCGATTTGGTGGAGGTAGAGCTTCTCCTCCTCC
GAGAGCGAGGTGGCGCGGTAGTAGTGGCGCGCCTTGTGCATGTCCGAGAGGTCGGCGCAGTACTCGCCGAGCATCAGCTCGAGATCCATCACCGCCTCGA
TGTCCTGCACCTTTTTCTCCAGCGCATCGATTGCGCGGTCCGTCCGCACCGCGTACTGTCCTATCATCTGCACCTTGTACTCCCCTTCCTTGATCTTCGC
GGCCACCAAAGCCTTGGCCTTGTCGT*CCATGGAAACCTCGACGGCGCCGGCGCCGGGCGCCGTTGCTGCCATCACGGGacggggggaGCGAGAGAAGGG
GAatttnctTTCGTCAGGGTtcacccctcgtgccga
page-top