Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14428  (registered. 2007)
Contig Information
Length 605 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glyoxalase family protein, expressed [Oryza sativa (japonica cultivar-group)] >gi|125585786|gb|EAZ26450.1| hypothetical protein OsJ_009933 [Oryza sativa (japonica cultivar-group)]
Score 486
Evalue 2.41162e-47
Total Hit Count 99
Registered year 2007
Contig Sequence     [ Download ]
>Contig14428
gggcAAGGAAGGCACAACAGCTCAAGGCAAACACCGCGCCATCTCAAAGTGGTCAGCAGTAGCACCCGTACGCACGGAAGGGACGAGCCATGGCGTCTGG
GGCGGTGAGACCTAAGCTCGCGTACATCGTCTGTTACGTCGACGACGTGGTCAAGGCGGCCGCCTTCTACGCCGACGCTTTCGGCTACAGCGTCCGCCGC
GTCGACGACTCGCACAAGTGGGCGGAGCTGGACACCGGCTCGACGACCATCGCGTTCACGCCGCGGCACCAGAGGGAGACGGACGCGCTCACGGGCGAGG
TGCAGCTGCCCAAGTCGCCCCGTGAGCGAGGGCCCGTGGAGATCTGCTTCGACTACGACGATGT*CGACGCCGCGTACCGGCGGGCCGTGGAGAACGGGG
CGGTGCCGGTAAGCGCGCCGGAGCAGAAGAACTGGGGGCAGAAGGTCGGCTACGTCAGGGATTTTGACGGGATCACCGTGCGCCTTGGGAGCCACGTCCG
CGAGTAGTGGCATCCTTGCTCGTGTCTACTGTAATGACTAGTAATGCTGTACT*CTGTCGATAGCAAATAATAAATCGCcatgtccagtgacagcaaaaa
aaaaa
page-top