Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14366  (registered. 2007)
Contig Information
Length 1335 bp
Clones 11 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 11
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit 11-beta-hydroxysteroid dehydrogenase-like protein [Triticum aestivum]
Score 1612
Evalue 1.86639e-177
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14366
ttattccgaagacaccaacgagaagatccacacgcactctcaaacacagaactaatattacaagcacacaacagagcactaatatcgcaaacccagaacA
CAGCTTAATTATTCGGTTTTTTTTTACAAACTAGCTAACCAACAGTAGCATCCACACCTAAAGCTCCATTATTAGAGAACAAACGAGCCTGCATGCACAA
CACAGCTAGGATCCACGTCGATCAAAGGATGCGAACTATAGTAAGTTTCTAGTCGTTCTTGACGTCTGAAGAGCTCAGCGAGGAGGGGTGCCACCCTGGG
CCATCGTCTTGCTCGGCGCATCGGTCTGGTCGCCGCCACCATGGCCGTGCATGTACAGGAGGCGGTAGCAGAACTCGAC*GACCTCCGGCGCAAACACCC
TCCACAGGTACATTGTTCCGAACCAGGACGGCACGGTGAGGTAGCGGTCGCCTTGGCGAGCTGCCTGCACCATGGCCCTCGCGCACTTCTTGGCGTACTC
CACTGGGAAGAGGCCGATTTGAGCATCTCGATATTCTTGATCAACCTCCACGCCGCCGTCCTCCTTCAGAAACTTTCCTTTGGACATCTCGGACTCGATC
CACCCGGGCGTCACTATCGTGATGCCAACTTCACTGCCAAGCTCCGACCGCAGCGTCTCGAAGAAGTTAATCAGTGCGGCATTGGCAGCATTATAGAAAA
CCATGCACGGAACGGGGTTCCATCCGGTTGCGGAGGCGGTGACCACGATCCTCCCTCGGGTCCTTTTAAGATGAGGTAGAGCAGCAAAAGTGGACTGAAC
TGCGCCCCAGAAGTTCACATCAAGCTGAGAGCTGTAGTTAGTGACATCGGGAATCTCCTGAAAAGCGCCTACGCTTGCAATGCCAGCGTTGCACACAAGA
TGGTCCAATCGGCCGAAGTGGTCGACCGCGGCCTGAACGAATCTGTTGCAGTCGTCGGGGTCTGCGACGTCGCCGGGGAGAATGATGACATCCGGCGCGC
CGAGCTCGAAGGCGCGGTCGGCGACTTGCCGGAGGCTCCACTCCCTCCTGGCGACCAGGGCGAGGCATGCCCCCTTGGTGGCGTACTGGTAGGCCAGTTG
CTCGCCGATGCCGGAGGAGGCGCCGGTGATGAGGACGACCTTGCGCTTGAGGTCGTCGGGGAAGAGGTAGGAGAGGAAGGAGTAGCAGAGCTTGAAGAGG
TAGTAGGGCGGGTAGAGGAGCAGGAGGGTGGTGACCATGGCGGGCATCGCCGCCCAGTTGAGCACGCCGTTCACCAGATCCATCGTCT*CCGgccggccg
gcaggtctctctctcggcagctctctctcgaccgc
page-top