Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9317  (registered. 2012)
Contig Information
Length 682 bp
Clones alternative view 9 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_DPA20 Seed DPA20 1
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 1
WH_XA Root 1
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 1
WH_XD Root, treated at 50 microM Al for 6h 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|218192967|gb|EEC75394.1|| hypothetical protein OsI_11879 [Oryza sativa Indica Group]
Score 296
Evalue 2.00E-78
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9317
TTTTTTTTTTAAACAAACTGCTCCAATGCCACTGCATAATCAAGCTTCCCATTACACGGAACAACATTATTCAAGTATCACAATGTCAGTGCCAACTAAA
CACCCTGATTTACGACCATTTATGCTTGTTTCAGAACACCACCATCACTCAATGTGATTTACACACAAATCGACACCTTAGCTGCCACGGTAAGTGGTAA
AGGAAAAGGGAGAATGCAAAAGAGGAACATGGAAATGCTCGGTCGTCTGGCTTCTTTTTATCTCAAATATGATGCTCACGTAAGGGAAGAACCCTGATGG
TGCATACTTGGAGGTATTGAAACTTATGCGATAGAAACCAGGAGCGACATTGTCAACGATATCCATCAGCTGACCGCTGCGTCCATCATTGTTTGTGACC
GAAGTGCCTAGGGTTGTCCATCCCTTGAATTCTTTGTTGTCAAATGCCGGGGTACTTGACGCGTCCTTCCACATCTCCAGGTGAACTTCAATTCCAGCTG
CTGGCGATCCAAGAGCCGTGTCCAGCACATGGGTTGTGATAGGAGGGCGTGTCCGGTTGGAGCTACCTGTAATTTCAGGAGCTTTATTGGCAGAAAGCTG
GGAAAGAGCTCCAAGGTGTGCACCAATAATCCGCATCCGATCTGCAGCTTTATCCGGTTGGCTAATATGATTTTCACCTGAA
page-top