Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9315  (registered. 2012)
Contig Information
Length 838 bp
Clones alternative view 5 Clones [Download: TSV  ,  FASTA ]
Wh_r Root 1
Wh_SHDr Shoot grown with dessication 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 1
WH_XB Root 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|125541221|gb|EAY87616.1|| hypothetical protein OsI_09027 [Oryza sativa Indica Group]
Score 332
Evalue 4.00E-89
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9315
GGTGAATTTTTCCAACTAGTTCATGCAGCAGGTCACAATATTTCTGTTCATTGGTTAAAACTTCGAACATACGTACGTAACCAGACCATGTAACCACACA
ATTCAAAATTCCCACAAAAATGGAACCAGAAGCAGACATAACCGTGGCAGCCCAGTTCCATGAACCCGAACACAACATACATTCTTCTAAAACATCCTCA
GACAGGCAAACTTTACACACGGTAGGCTATGTAGGTTTTCTACGCATTGTAGTTGTCCAAGCCCAGGTCTCTCAGGGCATCTGTGGCGGCAGCTTTGCAG
CTTCCATGTATTGCCTTGGCTTTCCTGATAAGCTTCTCCACACCTTCGTTGAGCAAGATCGTCCTGTTTTCAGGGTTTCTGACCACGAGATTGCGAATCA
TAAGGCATGCTTGCTTCTGAGTCAGCGCGGAGGAGGGGAACTTTTGCATTGTATGTATGGCCAGAGTGCCGTAGCCTAGCGCGACTGCACGTGCTGCATG
TTCTGGTGACCGCAATGTAAGGACTTGCACGATAGACATTACCTCCTGTATTACTGACGGGTCTTCAGAAAATCTGGACGCTAACTTCAAGAACTTGTCA
AAACCATCTTGCTGAATGATATTGGCCTTGTTTGCATCACTTCCAGCCAGCTTAGACAGCAAAGAGCAGCAAGATTTTGCTATAACTTTGTTCTTCTGTA
CGCCAGCCTCATCGATGCACTTAAGAAGCACATCAATCCCACCATTTTCAGATATGGACCGGCATATTTCTTCATTAACAGCAATTGCCTTCAAAGCAGC
ACAAGCTGATGGTAAGCTGGATGGAGCAACTTGCTCAC
page-top