Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14265  (registered. 2007)
Contig Information
Length 863 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0565600 [Oryza sativa (japonica cultivar-group)] >gi|113532888|dbj|BAF05271.1| Os01g0565600 [Oryza sativa (japonica cultivar-group)]
Score 751
Evalue 9.41525e-78
Total Hit Count 228
Registered year 2007
Contig Sequence     [ Download ]
>Contig14265
atttttccaaacaggnggccacaTCACTGCAAGCTTAACcaaattcATGGCAAATCCACCGACCACCGAATCATGGGCACGAACTTAGTTCAAATACAAA
ATCAACATTGAGGATTCGACTTTGTAGATGCGCTTTATACATCTCTGACTCCAATGTTTGAAGAGCCCAAGAGAAACTGGATCTTAGACATATCTGGTCT
TCCCATGAAAACCCTGCTTCTTCACCACTTTGAATGTTGACTGCAGCTTGGATAGAGCGACAGGGCACTCTCCC*TTCTCATCATACTCATCAAACTCTC
CTTCAGAAAGATCAATGTCAAATGGTGTCCCATGTACAGATTCAGCCTTCCAGCCATTACCAAAAGCGAACTCAATAGGTTCATAGCCTCTGCATTCAAA
GACCATCAAACAAGTCATCTCTCCTTTCTGGCTCTGCTCAGCAGTCAGTGGTGTTCCCTGCCCAGGAATCACCACAACTGATCCCTCCCTCGAACATAAC
TTGCACTTCTGGAGGAGATTGGCGGTGCCTTTGCCAGTGGGCAGTTGGACGACCTCGTCGAGGGAGACGCAGGTGGTCTTGGCGCTCGTCTCCCCGCAGC
TCTCGCACCGCAGCTTGAAGTAGTAAGGGTAGCTGGGG*TCGTCGCAGCCGCCGCGGGGCTGCAGGTTGGTGAGGCCGTCGAGCTCTGCCCCCACGAGCA
GCGCGAAGAACACCATCTCCCCTCCGGTCGACGGGGTTGCCGCCGCCTCCTCCTCTTTCAGTCCTCGCTAGGGTTGGGGGCTTGGGTTTTTGGGTCGCGT
CGGTGGCAGACGAAGCCTTGAGAGGAGAAGTGGGCGGGTTTGGGTTTGTGTGTTCGCTTTgcc
page-top