Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig931  (registered. 2012)
Contig Information
Length 1097 bp
Clones alternative view 35 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 7
Wh_r Root 3
Wh_KMP Shoot grown under continuous light 4
Wh_PCDAM Anther at meiosis 4
Wh_VWD Shoot grown with dessication 1
WH_XI Two-week old seedlingsi22Ž 16L-8Dj 1
WH_XK Shoots, two-week old seedlings treated with 150-mM NaCl for 6h (22Ž 16L-8D) 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23Ž ) 1
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_SP 1
WH_XA Root 1
WH_XB Root 1
WH_XD Root, treated at 50 microM Al for 6h 2
WH_XE Seedling, infected with leaf rust 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|226507032|ref|NP_001149807.1|| transmembrane BAX inhibitor motif-containing protein 4 [Zea mays]
Score 429
Evalue 4.00E-118
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig931
AATTCGGCACGAGGGACGATTACGAAGCGTGCCCAGCTCCATCTGCTTTCCTTTTCCTCCCCCTCCCCGTCTCCCTCCGACCCCCGGCCGAAACCCTAGC
GAGCGAGAGGCGCGATGTTCGGCTACCGGAAGGCGCCGGACCTCGACCTCGAGGCGGGCGGCTCCGCGGCGCTCTACCCGGGGATGACGGAGGACGTGGA
GCTGCGCTGGGCCTTCATCCGCAAGATCTACGTCATCCTCTCCGTGCAGCTCGCCATGACCGCCGCCGTCGCGGGCTTCGTCGTCAAGGTCCCCGCCGTC
TCGGAGTTCTTCGTCTCCTCCAACGCCGGCCTCGGCCTCTACATCTTCCTCCTCGTCCTGCCCCTCATCGTGCTGTGCCCGCTGCGTTACTACCACCAGA
AGCACCCCGTCAACCTCATCCTGCTCGGCATCTTCACCGTCTCCATCAGCTTCGCCGTCGGCATGACATGCGCCTTCACCAGCGGAAAAATCATCTTGGA
AGCTGCAATTCTCACAGCAGTGGTGGTGATCAGCTTGACTGCCTACACTTTCTGGGCTGCAAAGAGAGGCCATGACTTCAACTTCCTGGGCCCCTTCCTG
TTTGGAGCTCTTATGGTGCTGATGGTGTTCTCACTTATCCAGATCTTTTTCCCACTGGGCAAGATCTCCACCATGATATATGGGGCCGTGGCGTCGATCA
TCTTCTGTGGCTACATCATCTTTGACACGGACAACATCATCAAGCGCCACACGTACGACGAGTACATCTGGGCTGCTGTGTCCCTCTACCTCGACATCAT
CAACCTGTTCCTGAATCTGATGCAAATTCTGCGGGCAGCCGATAGCTGAGCGCACCTGAGCCCTGCTCGCCTTGATTTAAGTCCACTAGCTTGTGCATAT
CAGAAAATTCATGAATGCCCGCGGATACCTGTAGGCATGTGCAATCGTTATCAGTAAATTCTGCCGTCCTAGACTCCATGACATGTCTTGTTTCCTAGCT
TCCTGGAGTATGCAATGTGTGATTGAACTAAGCTGCACGATGAAAATATATTCGCTGGTGCTTTGTGACTGCAAGACTCTTGAATTTAAAAAAAAAA
page-top