Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9302  (registered. 2012)
Contig Information
Length 650 bp
Clones alternative view 44 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 1
Wh_dL Crown of seedling 1
Wh_e Seed DPA10 2
Wh_f Spike at flowering date 1
Wh_DPA20 Seed DPA20 2
Wh_EMI Dormant seed with water absorption after breaking 1
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 3
Wh_KMP Shoot grown under continuous light 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_PCDAM Anther at meiosis 4
Wh_SHC Shoot grown with cold treatment 6
Wh_V483 Shoot grown under cold condition for 3days 2
WH_XQ Leaves, seedling were infercted with blast strain Pr58 for 4 days (27℃ ) 2
WH_XU Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 3
WH_XB Root 4
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|45645202|sp|Q96564.2|RS27_HORVU|RS27_HORVU RecName: Full=40S ribosomal protein S27; AltName: Full=Manganese
Score 183
Evalue 1.00E-44
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9302
TTTTTTTTTTAGCAACAAACGATTCAAGTCATATACCATAGAGGGCAAGCAACATCAGAAGGAACAACAATTCACCAGACAACCATATTTCCTGGCAGGA
ACTACTAGTCTGATCTCACAGGCCAAACAGAACATAGTACAGTGTCATAGTAATATTGCTCGAGCTAGATACCAAATTACCAAAGATGGATTCAATTTGC
CGACATTGCAAAATTTTCAGACCAACACCCTTGAAAAACTAACGAGTTCAACAACAGCTTGCTTTTTAAGATAGCCTTCGGTTTAGTCGCCCTTGCGGCG
GAAGGAGCAACCCTCGGTGAGCCTGGCCTTACCACCCGTTGGCTGGCAGAGCACTGTTTGGCAGCCTGGGCACACCACAACAGTCTGTGAGTGGCTGAAC
ACAGTAGTGATGTTGAAGCAGCCCTGGCACTTGACGTCCATGAAGAAGGAATTGGGGGACTGGACGAGGCGCTTCTTCTTGTGCTTGAGCTTCTCGAGCT
CCGCCGGCGGGTTCAGCAGGTCGATGTCGTTCTGCAGCACCATCGTGGGAGGCTAGGGTTTGCTCGGGAACCGCGCTCTCTGGTCTCCAGCAGCGGCAAT
CCGAAGAGGAGGCGGCGGCGGCGGCCCTCGTGCGGCACGAGGCCTCGTGC
page-top