Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14129  (registered. 2007)
Contig Information
Length 1240 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_h Spike at heading date 1
Wh_oh Pistil at heading date 5
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit expansin EXPB2 [Triticum aestivum]
Score 1427
Evalue 6.79576e-156
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14129
gaggaaccgagcaggccatccctCACTCCCCACCGCCACTCGTCAGATCCACGCACCACAGCGCGCGGCATGGGCTCCCTCCCCCTCGCCGTGCTCGCGG
CGCTTCTCTGCTGCTTCCTGGCCGTCGGCGGCGGCGCCGTGGAGCTCAACACCACCGACCCCTCCCCCTTCGACGTCGACCTCAACGCCACCGACGCCAC
CAAGTACTGGGGCCCCTGGACCCCGGCCAGGGCGACTTGGTACGGCCAGCCCAACGGCGCCGGCCCCGACGACAACGGTGGTGCCTGCGGCTTCAAGCAC
ACCAACCAGTACCCGTTCGCGTCCATGACCTCCTGCGGCAACCAGCCATTGTTCAAGGACGGCAAGGGATGCGGTTCATGCTACAAGATCAGATGCAGGA
AGGACATGTCGTGCTCCGGCAGGACGGAGACGGTGATCATCACCGACATGAACTACTACCCGGTGGCGCCCTTCCACTTCGACCTCAGCGGCACTGCGTT
CGGCCGGCTCGCCAAGCCCGGCCTCAACGACAGGCTCCGCCACTCCGGCATCATCGACATCGAGTTCACACGGGTGCCGTGCGAGTTCCCGGGGCTCAAG
ATCGGGTTCCACGTGGAGGAGTACTCGAACCCCGTCTACTTCGCGGTGCTGGTGGAGTACGAGGACGGCGACGGCGACGTGGTGCAGGTGGACCTCATGG
AGTCGCGGGGGCCGGGCGGCGGCAAGTGGACGAGGATGAGGGAGTCGTGGGGCTCCGTCTGGCGCCTCGACTCCAACCACCGCCTCCAGGCGCCCTTCTC
CATCCGCATCCGCAACGAGTCCGGCAAGACGCTCGTCGCCAACAAGGTCATCCCGGCCAACTGGAGGCCCAACACCTTCTACCGCTCCTTCGTCCAGTAC
AGCTGAACCCACCATGATTCCGTTGCTCGGAGCACTAGTAATGCTACTACGCGGCTAGCTGCTACGGTCAAGTGAGTCAGTCGGTCATTGGGAGTGTACG
GTCGTTTGCGTTGAGTCGTTGTAAACTGTATCGGGTTGGGGTGGTGTCGGTGCGTCTTTCTAGGTGAGAAAAGTTTGGCTGGGTGTGGGTCTGGGTCACT
AGGGGTGTGATGAGTCGTGTATTGGCAAATGGGAAAAGGCTGTGTGGGAAATGGAGGAGGCAGGCGTACAAGATACGCTCTCCCGCCCACTCTCGCCTTT
Tataatttatatatcattcaaggcggtatataatcgaaag
page-top