Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9297  (registered. 2012)
Contig Information
Length 916 bp
Clones alternative view 47 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_r Root 4
Wh_DPA20 Seed DPA20 2
Wh_HGCPCDAM Anther at meiosis of MT4B CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VABA Shoot with ABA treatment 2
WH_XL Roots, two-week old seedlings treated with 150-mM NaCl for 24h (22 16L-8D) 1
WH_XN Leaves, plant was grown at constant 23 1
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 6
WH_XP Leaves, seedling were infercted with blast strain Pr58 for 4 days (23 ) 5
WH_XS Roots, 18 day old plants were grown hydroponically (supplemented with 10 mM Boric Acid for 24 h) 2
WH_XA Root 2
WH_XB Root 2
WH_XC Root, treated at 50 microM Al for 6h 2
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 5
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23 ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|14522834|dbj|BAB61039.1|| iron-deficiency induced gene [Hordeum vulgare]
Score 421
Evalue 6.00E-116
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9297
ATTTGGATGGACATGAATCCGTTTTCATTACGCCGTTGTTGACACTGAATCATTTATTATTCAATACAGGCATCATCGCCAGGCAAAGAAGTTTCCATGA
AACATTTTCAAGCAGGTTTTGTGCAAACTACCACACAAGTGATACAGGATCGATGCTGGTATGGGTACACGGCGAAAGCCAATCACACATCTTATTCGGT
AACCTTTTGGTGTGATATGTAGATACATACAGAAGACTCACTCGCTGCCGAACACTGTAGGAGCCATCAACGAGCTTCGACGGTTTGGTTCCCACCTCTG
TTGATAATCTTGTCGACATACTCCTTTCTAGCTGGGAGATGGTCATGGGGACGATTGTAAGGCGTCCAGATAGGCTCTCCCACAAAGAGCCGCATTGCCT
TGATGTAGTTGTCACTATCCAATGTAAAGCGGTGATACATTCCTGCAGGCAAAACAATCATGCCACCTTTCTTAACTGCTATACGGATCCACTGTTCATT
TTGGTCCCTCACATCAAAGTATCCACTGCCCTCAAGACAATAGCGTATCTCCTCATCAGTATGCAAGTGCTCTTCAAAGAAATTCTTCAGCTTGGCCTCA
TAGTTTGGCAATTTCTCAGGACATACGTCGCAGATGTCCACATAGGAGTATCCCCTGGCCTCACGGATTTTCTTGAGATTCTCGTCTTTCTCCCAGTTAT
CAGCATTTAGGTTCCAGCTTACAACACCTAATTCTGAAAGTTTGGCAAGAGGAATGAACTCTTTGGGCTCACGGTGGTGAGGAAGCCTCTGATCCTCTTC
ACTGTCATCCATGTACCATGCTTGGATGACCTCCTCCTTGCCATCCTGGAACTCGTTCTCCATGGCGGCAGCCTCTCGCAGTCTCCCGCGCCCTGCTCTC
GCTGCCTTCCTTCCTT
page-top