Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig14080  (registered. 2007)
Contig Information
Length 1295 bp
Clones 10 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 6
Wh_oh Pistil at heading date 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypersensitive-induced reaction protein 2 [Hordeum vulgare subsp. vulgare]
Score 855
Evalue 6.59116e-149
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig14080
aggaattcggcacgagggtccgcGCTGAAGAAGCGG*AAAACCCCAGG*CGCCCAACGACCTTCCTTCCGTCGAAACCAT*CCTCCGACTCCTCCCTCAT
CTCCCTGCTCGCCGAGGCTCAGCTCAGGATAAACCATGGGTGGCGTTTTGGGTTTAGTGCAGGTTGATCAGTCAACTGTTGCTATCAAAGAAACTTTTGG
GAAGTTTAATGAGGTCCTGGAGCCTGGTTGCCACTTCTTGCCTTGGTGCATAGGGCAACGGATTGTTGGTTACCTCTCACTGCGTGTGAAACAGCTAGAC
GTCCGATGTGAAACCAAAACAAAGGATAATGTCTTTGTGACTGTTGT*TGCTTCTGTCCAATACCGTGCCCTTGTTGATAAGGCATCTGATGCCTTCTAC
AAACTGAGCAACACAAAGCAACAAATCCAGTCGTACGTCTTTGATGTTATTAGAGCCACTGTctcCAAAGCTGGAGCTGGACGATGCATTTGTGCAGAAA
GATGACATTGCAAAA*GCTGTTGAAGAGGAGC*TTGAAAAGGCGATGTCTATGTATGGGTATGAGATTGTGCAAACTCTGATAGTTGACATTGAGCCTGA
TGTGCATGTCAAGAGGGCAATGAATGAGATCAATGCAGCTTCAAGGATGAGGTCTGCAGCCAATGACAAAGCGGAGGCTGAAAAGATTCTTCAGATTAAA
AGAGCAGAAGGAGAAGCCGAGTCAAAGTACTTGGCTGGTGTGGGCATTGCAAGGCAGCGTCAGGCTATCGTGGATGGTCTGAGAGACAGCGTCCTCGCCT
TCTCTGAGAACGTCCCTGGCACCACTGCAAAGGACATCATGGACATGGTTCTGGTCACCCAGTACTTCGACACCATGAAAGAGATTGGGGCCTCATCCAA
GTCTTCTTCGGTGTTCATCCCCCATGGTCCTGGAGCCGTCAAGGATGTCGCATCGCAGATCAGAGATGGGCTCCTCCAGGCCAACACTCTCTAAGAGGAG
GACCATGGAAAAGGATAGCTTCTGTTTTGCAAGAGTTGTGAAGTTCTTCATCATTCACCATTACGCTAAGAACATATTTTATGCGACAGATATTTGGCAA
GGTCGTGAGTAATTTATC*TACGTGTGTGAACTAGTACGTTAAGTTGTGAATTTTACATGGTGTGAACTACTACTACCTAGATAATCAGACTTGCATGGA
Gtgggtttctgtaagaaaagtttagccagattcctgaatggtacttgttgctgcttgcaagtgagccggatgtttaccaggcttatctaattatt
page-top