Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13977  (registered. 2007)
Contig Information
Length 647 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_h Spike at heading date 2
Wh_r Root 2
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit small nuclear ribonucleoprotein E [Zea mays] >gi|195611048|gb|ACG27354.1| small nuclear ribonucleoprotein E [Zea mays]
Score 419
Evalue 1.66524e-39
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13977
ttttttttttagtcaacAAGGTCTgttcatgtcaatCTTAAACGCAACCGATAAGCTCATCATCTTGATCAAACATCTTGCACGGAGTCGACAGAATGGA
TTTACTGGGTCTGGGTTCATAGATAGACAACAGACGTTACATATGCTCAGTGACCACAACGACAAGCTACATGCATTTCAGCCTGGGTGGAGTTCAAAGT
ATCACAGGAATGCTCAACACAGGAACGAGAACGCCA*GCCATCCTAGAGAGAGAAGCTTCACTTTCCAGTGTTCATCATCAGAGTTATGTTGTCACCTTT
CAAGAGTATCCTTCCCAACGATTTCCTGGTGTTCTTCTTAATGTTGATTTCCTCAGCATCCTCGAGAACCAGGTTCATGTACTCATCAAAGCCGATGATA
CGACCCTCGATCCGCATATCCTTCTGCTCGAAAAGCCAGATCTGGATGCGCGCTTTGCTCTGGAGGAACCGGAAGATGAGATTGATGGGCTGGGTCATGA
TACGCTGGACCTTGGTGGACGCCATGGCTGCTGCGCGGCGTGAGCTGCTCCTCCGACTGAAGTGTCTAGAAGCTTCTGGAGGGAAGCGCGTGTGGGCAGG
CGGAGCGGGGAGGTAAAAACCCTAGATACGCCGCAGAGGAAGGGGgc
page-top