Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9282  (registered. 2012)
Contig Information
Length 741 bp
Clones alternative view 88 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 9
Wh_f Spike at flowering date 5
Wh_h Spike at heading date 4
Wh_oh Pistil at heading date 2
Wh_r Root 1
Wh_yd Spikelet at late flowering 1
Wh_CSEC Callus 4
Wh_DPA20 Seed DPA20 2
Wh_EM Dormant seed with water absorption 5
Wh_EMI Dormant seed with water absorption after breaking 4
Wh_KMV Shoot grown with continuous light after cold treatment 2
Wh_MS Seed DPA5 of DT3DL CS wheat 2
Wh_SHC Shoot grown with cold treatment 2
Wh_VSCB Liquid cultured tissue 1
WH_XN Leaves, plant was grown at constant 23℃ 2
WH_XO Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 4
WH_XR Roots, 18 day old plants were grown hydroponically 2
WH_XT Roots, 18 day old plants were grown hydroponically 4
WH_XA Root 6
WH_XB Root 8
WH_XD Root, treated at 50 microM Al for 6h 9
WH_XF Seedling, infected with leaf rust 1
WH_XG Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XH Seedling, infected with powdery mildew (AvrPm3b) 2
WH_XV Leaves, plant was grown at constant 23℃ 2
WH_XW Leaves, seedling were infercted with blast strain Pr48 for 4 days (23℃ ) 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|242079855|ref|XP_002444696.1|| hypothetical protein SORBIDRAFT_07g026170 [Sorghum bicolor]
Score 221
Evalue 6.00E-56
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9282
TTTTTTTTTTGGAAGAAACTTTTGGGACATGCAAAAGTGAACTTAAATGGTCACAAACAAAACCCAGAGATGCCACACATAACTAATACCTGGACGGTTT
CCATCAACATTCCAAAGAAAGTGCCACCCAAGCAACGACAATACATGGGAAACACAAAACAAAAGAAGATCTGGTGGATGCCTATCAAGTCTGGCAATTT
TTTGCGATAAATTGCACAAGCTGGCGAACAAACAAAGAGTCTGCAGCATCATCATTTGATGTTCATTGTTTCAACATAAATCCCTGAACAAGTTCTTTGC
CGCCAGAGCGGTCGCCCTTCCTTAACCATAGTTCAGGCGGAACATGTCGTTCTGCACGTAGAAGCTCCCTCCAGCTGGCAGCAAATGGAACATCTGTGAG
AACTTGAGGGGGTGCTCGCCGGGGCCGGTGGTGATGGTGCCGGAGACGAAGACGAGGACGCCGCCCTGGGGCCCCGAGGGCTGGCAGTCGACGGTGTCGA
TCTTGTGCTGGCACTGCTGGAAGGGGAGAGATCCGAGCTTGCCGGCGATGGCGGCGGGGCCGCCGAACTTCTCGCCCTCGAAGGTGAGCATGGAGCCGTC
CTGGTACAGCCCCACCAGCGCGGCGCGGTTGGAGTCGAACGTGTGGTAGTAGTGCTGCACGAACGCCTTCGAGACCGAATCGGGATCCATGGCCTCTCCC
TCCTCGCCTCGCCTCGCCTAGGGTTTGGAGCTCTGGATGCG
page-top