Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13962  (registered. 2007)
Contig Information
Length 1667 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os03g0780600 [Oryza sativa (japonica cultivar-group)] >gi|73920810|sp|P37832|TBB7_ORYSJ Tubulin beta-7 chain (Beta-7-tubulin) (pTUB22) >gi|12957711|gb|AAK09229.1|AC084320_16 beta-tubulin [Oryza sativa (japonica cultivar-group)] >gi|108711382|gb|ABF99177.1| Tubulin beta-7 chain, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|108711383|gb|ABF99178.1| Tubulin beta-7 chain, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113549922|dbj|BAF13365.1| Os03g0780600 [Oryza sativa (japonica cultivar-group)] >gi|125545910|gb|EAY92049.1| hypothetical protein OsI_13743 [Oryza sativa Indica Group] >gi|215767676|dbj|BAG99904.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1344
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13962
caccggcggcggcgaaggcacGATGAGGGAGATCCTGCACATCCAGGGCGGGCAGTGCGGGAACCAGATCGGGGCCAAGTTCTGGGAGGTGATCTGCGAC
GAGCACGGGATCGACGGGACGGGGCGCTACGCGGGGGACTCGGACCTGCAGCTGGAGCGGATCAACGTCTACTACAACGAGGCGAGCGGGGGCCGGTTCG
TGCCCCGCGCCGTGCTCATGGACCTCGAGCCCGGCACCATGGACTCGGTGCGCTCCGGCCCCTTCGGCCAGATCTTCCGCCCCGACAACTTCGTCTTCGG
CCAGTCCGGCGCCGGCAACAACTGGGCCAagggtcaCTACACCGAGGGCGCCGAGCTCATCGACTCCGTCCTCGACGTCGTCCGCAAGGAGGCCGAGAAC
TGCGACTGCCTCCAGGGATTCCAAGTTTGCCATTCTTTGGGTGGAGGCACTGGATCTGGGATGGGAACCCTTCTTATTTCTAAGATTAGGGAGGAGTACC
CTGACCGAATGATGCTGACCTTCTCTGTCTTCCCGTCACCAAAGGTCTCAGACACCGTTGTTGAGCCATACAATGCTACACTTTCCGTTCACCAACTCGT
TGAGAACGCTGATGAGTGTATGGTGCTTGACAATGAAGCTCTATACGACATATGCTTCCGCACGCTAAAGCTTGCCACCCCTTCCTTTGGTGACCTGAAC
CATCTTATCTCTGCTACCATGAGCGGTGTCACATGCTGCCTGAGGTTCCCTGGACAACTCAACtccgatcttcgCAAGCTTGCTgtcaatCTCatcccat
tcccccgTCTCCACTTCTTCATGGTTGGctttcgcgccgCTGACgtcgcgTGGGTCACAAATGTACCGTGCTCTCaccgttcctGAGCTGACTCAGcaaa
tGTGGGAtgccaagaacatgatgtgcgccgcagacccccgccatggccgctacctcaccgcctccgCCTGCTTCCGagggaAGATGAGCACCAAGG*AGG
TGGACGAGCAGATGCTCAACGTCCAGAACAAGAACTCGTCGTACTTCGTTGAGTGGATCCCCAACAACGTCAAGTCAAGCGTGTGCGACATGCCGCCCAG
GGGCCTGAAGATGGCGGGCACCTTTGTCGGCAACTCCACGTCCATCCAGGAGATGTTCCGCAGGGTGAGCGAGCAGTTCACGGCCATGTTCAGGAGGAAG
GCCTTCTTGCACTGGTACACGGGCGAGGGCATGGACGAGATGGAGTTCACCGAGGCCGAGAGCAACATGAACGACCTCGTCGCAGAGTACCAGCAGTACC
AGGACGCGACCGCTGAGGAGGAGTACGACGACGAGGAGGAAGAGGAGCGTGACGCGTAGTAGTGGCGATCGCGCTCCGCCAGCTATATGTCCCCCGCTTC
AGGTCTGTCGCTGTGTCCAGTGAGAGTTTGTGGTTTCCTCCTGTGGCTTGGATGAGTCGAGGTTGCGTCTTGTACTCCGTTTTGTAATTTGCTACGGCTA
GTAGTGCGTTGCAGTGTGTCTTGTTCCGCATCCATCCTTTGGTCGGTCGGTCGGTCCATAGCTGACGGTGGCCTGAACTGTCGAGTGCTCTCCCTGAGCT
GGTCGTCGTCGCCTTGTAAGTTCTGACAATTATTATTGTTAGTCGTTCGCTTCAGCAACcaaaaaat
page-top