Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13959  (registered. 2007)
Contig Information
Length 1542 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_h Spike at heading date 1
Wh_yd Spikelet at late flowering 1
Wh_yf Spikelet at early flowering 5
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit H0820C10.3 [Oryza sativa (indica cultivar-group)] >gi|218194291|gb|EEC76718.1| hypothetical protein OsI_14737 [Oryza sativa Indica Group]
Score 1694
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13959
ttcgcggtCTTGTCCAAGACCTTAAAAGGGTCGCGACTGGAATGGGACTCGAATATGAGGacccccatacTGTAatcgaAGAGAgcccatcACTGAGACG
AGCTCCGGTGGCACGAAGAGTGGAGGAGATgtttgcCCAGATAAAGGCCAAGCTACCTGGAGCACCCTTGTTCctcttgTGCCTCCTCCCTGAGAGGAAg
aattgCGAAGTTTATGGTCCTTGGAAgaaaaagTGTCTTGCTGATTTCGGCATAGTCACCCAGTGTCTAGCTCCGCAAAGAGTCAATgatcaGTACTTGA
GTAATCtgctgCTCAAGATAAATgctaagcttggtgggctCAACAcattgCTTCAAATTGAAGCAGCCCGTGCAATACCCATT*GTGGGGAAGGTGCCCA
CTATCATCCTGGGCATGGATGTCTCGCATGGTCAACCTGGCCAAtcCGACAGGCCTTCCATTGCTGCGGTGGTGAGTTCTCGTGAGTGGCCTCTCATCTC
TAAATACAGAGCAACAGTGCACACTCAGTCACCCAAACAGGAGATGATGGCTTCCCTGTTtaaaccacggggaactgaagatgatggcctcattcgggaa
tctcttattgacttctacactagctctgggaagcgaaagccagaccaagttattattttcagGGATGGAgttagCGAAAGCCAGTTTACTCAGgtgatAA
ACattgaGCTTGAGCAGATCATTGAGGCATGcaagtgCCTTgacgaCAAGTGGGAGCCCAAGTTCacggtcattgtTGCTCAGAAAAACCATcatacCAG
GTTTTTCCAGACAAACTCGCCAGAAAATGTTCCTCCTGGCACtgtggtGGATAAACAAGTGTGCCATCCCAAGAACTTTGACTTCTACATGTGCGCGCAT
GCTGGGATGATTGGGACGTCGAGGCCAACGCATTACCATGTTCTGCATGATGAGATCGGCTTCAGTGGGGATGAGCTCCAGGAGTTTGTGCACTCGCTCT
CCTACGTGTACCAGAGGAGCACGACAGCGATATCAGTAGCTGCTCCGATAGCGTACGCGCATCTGGCGGCGGCGCAGGTGGGCACCTTCATGAAGTTTGA
CGACATGTCGGACACGTCATCGAGCCAGGGAGGGGGCCACACGTCGGTGGGCAGCGCCCCGGTGCCGGAGCTGCCTCGGCTGCACGAGAAAGTGAGGAGC
TCCATGTTCTTCTGCTGATCTGATGCTGCTCTCCGCTGTCTGTCAGTGGAGGTTGAACCGTGTGTCTGTATAAAACCTATCTATCTTATCTAGATGGCAC
CTTGAACTCTAGCTGTATGGGTGCCCGTAGAATGAACAAGTAAGTGGGTCGGTCTGTTGCGTTGGTGTCGCGCTGGGAACGTTCCCATGGATCGTTTGTG
TTTGTGTTGGCGTCGTTGAACCAAGCAACCTGAATCTAGCTTAACCTTGGATGATGTGC*GGCTAGCTAGACCTAGACGACTTGGgtggagtggaTAATC
AAGTTAagtggatgtgaatttgttgcagatggaaaaaaaaaa
page-top