Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13924  (registered. 2007)
Contig Information
Length 813 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_oh Pistil at heading date 3
Wh_r Root 2
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0754100 [Oryza sativa (japonica cultivar-group)] >gi|57899617|dbj|BAD87196.1| DNA-binding protein-related-like [Oryza sativa Japonica Group] >gi|57900332|dbj|BAD87285.1| DNA-binding protein-related-like [Oryza sativa Japonica Group] >gi|113533808|dbj|BAF06191.1| Os01g0754100 [Oryza sativa (japonica cultivar-group)] >gi|215695279|dbj|BAG90470.1| unnamed protein product [Oryza sativa Japonica Group]
Score 457
Evalue 1.02588e-43
Total Hit Count 85
Registered year 2007
Contig Sequence     [ Download ]
>Contig13924
tgtttaaaataaataaaaaattgcaagctgaaaggtgcataatccatttaGGAGatcaaatTGTATATTACTGCTCAGCACATCA*CATTTGTTCTCAGA
AACACAACTGCTGCAGCAACTAACAATCACTCATAGATAGAAATGCTTGATAAGAAGGAACTTGCGGTAGTTCGAGCGAACAATTCCAATATGAACTCAG
AAGATCCATCTTTCACATTCTAGACAACTCAACAAGTAGATTTGACCAACAGGCTTGGGAAAGCACTTCTGATTAAGATGGATGTGATTTTCACTCTTCA
ACATTGACAAGTTCATACTCCACAAGTGAAAGATTGTTGTCCTCCTTTACACCGAAGCTTGCTGGTTCAGTTACTTCAACACGGCCCCATTTGTCAACAG
CAAGCCTCATTGACCCTTTGAACATATCAATCTTTGCATTGCGTATAATGACAGTGTTGCCAGGCTTCAAAACATCAACCTGGTCGTTGCGGGCGGTGAA
GAGGACGCAGCCGGTCTCGTCGCCGATGAGGCACTCGGCGATCCTGGTGGGCTTGGCGGCCGGGCCGGGGCCGCCAGCGGCGCGGGCCTTCTGGAGGACG
GTCTTGGAGCTGAGCACCTTGGCGACGAGCGTGTGGCCGCTGGTGACGGGCTTGAGCTGGTCCACCTTGACGAACACCGGCTTCCGCTTCGCCGCCGCCG
CCGTGGCCATGGAGAGGGATGCAGATAAGG*GTTGGGAGAGGG*ATTAAGGGGGTCGcgggtctncttgggagggccaaaccctagatggggtggggcga
gtttaatatgggc
page-top