Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13921  (registered. 2007)
Contig Information
Length 1026 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 2
Wh_h Spike at heading date 2
Wh_oh Pistil at heading date 1
Wh_yd Spikelet at late flowering 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Tropinone reductase, putative, expressed [Oryza sativa (japonica cultivar-group)]
Score 1117
Evalue 4.50618e-120
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13921
caCTGAGAAATGATACGCACAATTCTGACCACAACTTTCTTCACATGGCTGAtgcTGAACAATGGCGAATACTCGTGGAGTCTAGATTCAAGATGACCTC
GGTTTTACAGGAATATTTATTTTGGTTGCCAAGAACACAAGATATGACTGGGCTCCTGGGCAACAGAGCGAAATATGGCCTCTTCCTTGGTAGTCTTCAA
GCTGGATAGAGCCCATTGACAGTCATACCTCCGTCCACTGAGATCGTCTGGCCTGTTATGTAAGTGGAACCAGGCATGCAAAGAAAAGCAACCAGCGATG
ATACCTCTCCTGGTTCTCCGACACGCCCCAGTGGAGTTCGACTCACAACGGAGGCCTCAAATTCCTTGTTAGCCAAAAGTCCTTCTGTAAGCGAAGTCG*
TTATGTACCATGGAGCAACAGAGTTTGTTCTTATGCCATCTTTTGCCCATTCACATGCTAGGTTCTTGGTTAACTGGTTGATGGCACCTTTAGTCATGGC
ATATAGAGTACC*G*CTAAATACGGCTACTAATCCACAGACAGATGATATGAAAACAATGCTGCCCAAGCCAGATGCTTTTAGAAGAGGATGTGCAAGTT
GGCAAAGATGATATGCAGATTCAAGATTAGTGGCCATCAAAAAAGAGTAATCTTCAGCGGAAAATTCAGTAGTTGGCTTCCTTATGTTTGTCCCCACATT
GTTTACGAGGATGTTGAGCTTGCCGCCGAAGCGTTCGGCGACGTCGGCAATCAGGCGCTCCCGCTGCTCCCGGACGGAGAGGTCGCAGACGGAGGTTGTG
ACGCGGAAGCCCCTGGCCTCCCACTCCTTGAGGCGCTCGCCCAGCTCCGCCTCCTTCCGGGAGCAGGTGTGCACGGCCACCCCCAGCGCCGCAAGTTCCT
CCACCACCGCACGCCCGATCCCGCGGGTGCCGCCGGTGACGAGAGCCGTCTTCCCGTGAAGAGACCACCTT*CCTGGAGCACCCGGC*GGCTCGACCCCG
ACGGCtccctcgtgccgaattcctgc
page-top