Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13895  (registered. 2007)
Contig Information
Length 1296 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 4
Wh_h Spike at heading date 4
Wh_r Root 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit annexin p33 [Zea mays] >gi|6272285|emb|CAA66900.2| annexin p33 [Zea mays] >gi|194692460|gb|ACF80314.1| unknown [Zea mays] >gi|195623952|gb|ACG33806.1| annexin-like protein RJ4 [Zea mays]
Score 1423
Evalue 2.08892e-155
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13895
gaggaattcggcacgaggccctccccgcccggtctcgagatcccacatCGCACGCACCGCTTCCTCCGATCCCCGGCCGGCAGGCGCCCGAGCCCGATGG
CGACGCTCAAGGTCCCCTCCAACGTCCCGGCCCTCGCCGACGACTGCGACAACCTCCGCAAGGCCTTCCAAGGGTGGGGCACGAACGAGGCGCTCATCAT
CTCCATCCTCGGCCACCGCGACGCGTCGCAGCGCCGCGCCATCCGCAAGCACTACGCCGACACCTACGGCGAGGAGCTGCTCCGGAGCATCACCGACGAG
ATCTCCGGCGACTTCGAGAGGGCCGTGATCCTGTGGACGCTGGACCCGGCGGAGCGGGACGCGGTGCTCGCCAACGAGACCGCCAGGAAGTGGCACCCCG
GGAACCCCGTGCTGGTCGAGATCGCCTGCGCGCGCGGCTCCAAGCAGCTCTTCGCCGTCAGGCAGGCCTACCATGACCGCTTCAAGCGCTCGCTCGAGGA
GGACGTCGCTTCCCACGTCACCGGCGACTTCCGCAAGCTGTTGGTGCCACTTGTAAGCTCACACCGCTACGAGGGACCAGAGGTCAACACAAGGTTGGCT
CATTCAGAAGCCAAATTACTACACGAGAAGATTGAGCATAAGGCTTATGCTGATGATGAGGTCATCAGAATTCTCACCACCAGGAGCAAAGCTCAGCTGC
TTGCAACATTCAATAATTACAATGATACATTTGGTCACCCGATCACTAAGGATCTGAAGGCTGACCCCAAGGATGAGTTCCTCAAGACCCTGCGGGCGGT
CATCCGGTGCTTCACCTGCCCTGATAGGTACTTTGAGAAGGTGGCCAGGGTGGCCATTGCAGGGAATGGAACCGATGAGAACTCCCTCACTAGGGTCATC
ACCACCCGCGCCGAGGTGGACCTGAAGCTGATCAAAGAGGCGTACCAGAAGAGGAACAGTGTTCCCCTGGAGAAGGCCGTCGCAGGCGACACCTCCGGCG
ACTACGAGAGCATGCTCCTTGCCCTCCTGGGGAAGGAGTGAGCCTTGCCCCTGTATCCAATTCCACCCCCTGTTATCCTTTTATATATCTCGATCGGAGA
ATAAACCCTGGTGTGCAAGGCCGTAGTCACTCTGGTTATGACCTTGCATAACAGTGAGAATAAAATAGAGATGTGCTTTACGATGAGTCATATAGTAGTA
CCTTTTGTACTTAGATGCTGGCGTGTGAAATACCGAGGGCATATTGAAAAgtt*agTTTTCTGTAAGCctgaaaaatatatactccaaaaaaaaaa
page-top