Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13887  (registered. 2007)
Contig Information
Length 1059 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_e Seed DPA10 4
Wh_f Spike at flowering date 2
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit ADP glucose pyrophosphorylase:SUBUNIT=L
Score 960
Evalue 1.51796e-113
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13887
cagagacgaCGGGAAAacccccctgAAAATTTACAAGTCTAGATAGAGTTTTATTTACACGAACATCCCCCGGG*AGTTTGTTTGATCGCTGCCACTTCT
TTACCTCAACACACAGCCTCTTATTTATTACTCCCTCCGTAAAGAAATATAAGAGCATTTAGATTATTAAAGTAGTGATCTAAACGCTCTTATATATGTT
TACAGAGGGAGTACAGGGGAAAAACGACTATTACTTTGTTCCACTGCTACTTACTACTTACTTTACCACTAATGCTGCATGCGCGCGCCTTCTCTTTCAG
TCTCGATCATTCAAGCTTCAAACGTCTCCCGTCCCGGGATCACTTCTTCAGTCCCGGCCTCGAGACAACGACGACGATCAATGCAGCACAGAGGTTGTCG
CGCCGACCCGGCGGCGCTCTACACGACGGTGCCGTCCTTGATGGTCGCGTTCTTCTGGATCACCACGATCCCGGACCTGATGTAGTACCCTTCCTCCGGC
CTGTCGGCTTCTTGCACTCCCTCCTTGTTTGAGATGACCACGTCCCTTCCTATCCTCGCGTTCATGTCGATGATGCAGTTGCTGATCTTTGTGTTCTCCC
CGACGCCGATGGGGACCTTGCCCTCCGACATCAGCCTCGAGATCTCGTCCTCGGTCTCGTACGAGTCCGCGCCCATCATCATCGCGTT*CTTGAGCTCGC
TTCCGGAGTTTAGGCGTGAACGGACGCCGATGATGGAGTGCTCGATTTTGCATTCACGCAAGAAGCAGCCGTGCGAAATGATCGCTTCTTTGATCCTGCA
CTTGTCTGACTTTGTTGGTGGTAAGTACCgaggcgaagtgaagaagggagtttttggatcataaaattcaaactttggaggctgctcgcagagggccatg
ttcgcatcgaagaaggatctgattgttccaatgtcctcccagtagtcagtgaagacatatgcctgcacattgatcatgcagagctctcgggaggatttca
gacccaaagtcatgtagttctgcgtatcttgactttagaaggttcagcagaacatctct
page-top