Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13874  (registered. 2007)
Contig Information
Length 1075 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_f Spike at flowering date 5
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0608600 [Oryza sativa (japonica cultivar-group)] >gi|113649744|dbj|BAF30256.1| Os12g0608600 [Oryza sativa (japonica cultivar-group)]
Score 1421
Evalue 2.71364e-155
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13874
accccgatgtgaaggtacttgatgcctcttggtatatgcctgcagaacaaaggaatccccttcaggagtaccaggtggctcatatccctggtgccttatt
ctttgatgtcgatggaatatctgacagagcatctagtctgccacacatgctgccatctgagaaagcattttctgctgctgtgtcttctcttggcatctac
aacaaagatggaatagtagtttatgatggaAAGGGTCTATTTAGCGCTGCTCGTGTTTGGTGGATGTTTCGTGCTTATGGAcatgaCAAAGTTTGGGTTT
TGGATGGAGGTTTGCCCCAATGGCGTGCTTCTGGGTATGATGTTGAATCAAGTGCCTCTAGTGATGCTATCTTAAAAGCCAGTGCTGCTAGTGAAGCAAT
CGAGAAAGTTTATCAGGGGCAATCGGTTGGTCCCACCACATTTGAAGCGAAGTTGCAGCCTCATCTTCTTTGGAATCTTGGTCAGGTGAAAGAGAACATC
GAGACCCAGACACATCAACTTATAGATGCTCGAGGGAAGCCTAGATTTGATGGTGCAGTTCCAGAGCCACGCAAGGGAATAAGAAGCGGGCATGTGCCTG
GGAGCAAATGCGTTCCTTTTCCTCAGGTCCTTGACAGTACACAGAAGCTATTGCCTGCAGATGATCTCCGTAAGCGATTCGAGCAAGAAGGTATATCACT
TGATCAACCCATTGTGACCTCTTGCGGCACTGGTGTGACAGCATGTGTATTGGCTTTGGGCCTTCATCGCCTCGGCAAAACTGATGTTGCCGTGTACGAT
GGATCATGGACTGAATGGGGTGCTCACCCTGACACTCCAGTTGCTACTGCTGTTTAGTCTCACGCGGCGTGTATGGAGGACCATCTTTTGTACCCGCACT
TCTCAGCGATGTATGAAGGTCAGAAGGCAAAGGAAACTGAAGAGTGTGGGTGGGTGTAAGGTTGTGGAAGCGATGCTGTTCGGCGTTTTCAATGTAAATT
ATCGAAACAGAGAAAAATTGAATACATACTGTGTGAATCAATAGTTGATGATCCACctttctgtgaaaaaaaaaa
page-top