Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13858  (registered. 2007)
Contig Information
Length 1239 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 3
Wh_e Seed DPA10 1
Wh_h Spike at heading date 1
Wh_r Root 2
Wh_yd Spikelet at late flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit plasma membrane intrinsic protein [Hordeum vulgare]
Score 798
Evalue 7.79048e-158
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13858
ctTGCTTGGTGGATTGATGACTTAG*ATAGAAAGGTGGCGACGTTGGATCGATCATACATATGGTCGCTAAATTTAAATACAAGTAGGAAAAGCAATGCG
GGCTAATTAAGACAAGCGATCCCATGGACCGAATTACAAGACACGGCACGCATGACCGGACCACGTACTACGCATATGCAGCTGCCGACACATAATAACA
CGACCATTGCGGCGGCCGAACTGAACTGTCGAGAAGTTGCAAAAGCGCATTTCTCTCTGGATGGATGGACACAACACGGGTCGCCATTGCTTCAGTCTTG
CATACAGATGACATGGATGATAACTTGTTACGCGTTGCTCCTGAAGGAGCCGAGGGCCTTGATGGCGCCGGCCCTGAGGATGTACTGGTGGTAGAAGGCC
GCGATCGCCGCGCCGATCATGGGGCCGACCCAGAAGATCCACTGATCATCCCAGGCCTTGTCCTTGTTGTAGATGACGGCGGCCCCCAGGCTCCGGGCCG
GGTTGATGCCGGTGCCGGTGATGGGGATGGTGGCCAGGTGGACCATGAACACGGCGAAGCCGATCGGGAGGGGCGCCAGCACCGGGACGTGAGAGTCGCG
TGCGCTGCGCTTGGGGTCGGTGGCGGAGAAGACGGTGTAGACGAGCACGAAGGTGCCGATGATCTCCGCAGCGAGGCCGGTGCCCTTGGAGTAGCCGGCG
GCGAGCGTGTTGGCGCcgccgCCGTACCTGACgcaAGTAGGCGCTCTGGAAGGCCTTGACGAGGCCGACCCCGCACATGGCGCCGAGGCACtgggccacc
aTGTAGAGCAGCGCGCGGACCAGGgagacCTTGCGCGCCAGGAAGAGGCCGAAGGTGACGgccgggttgatgtggcccccggagatgccggcggtgcagt
agacgaggacgaagatcatgccgccgaaggcccaggcgatgccgagcacgcccacgccgccgcacgctgcgtcggcggcgctgttcaccgccgggtccgt
ctggtgcttgtacccgatgacggtggccacggtgatgtagaggaagagcagcgtggcgatgaactcggcgatgacggcgcGGTAGAGCGACCAGGAGGCC
AGCTCGGCCGCGTCGATCAGCGGGGCCGGCGGCGGGTCCGTGTAGTCCTTGGCCGCGAAGTCgccgccgCCGCCGGTCTCCATCACCTCGTCCTTGGCCA
TCGGCTTGTGTAGCTAGCCTTGCTGTTCCTTCTCGCTgc
page-top