Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13856  (registered. 2007)
Contig Information
Length 1317 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_dL Crown of seedling 1
Wh_h Spike at heading date 4
Wh_r Root 4
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os05g0499300 [Oryza sativa (japonica cultivar-group)] >gi|114150550|sp|P37834|PER1_ORYSJ RecName: Full=Peroxidase 1; Flags: Precursor >gi|51038054|gb|AAT93858.1| peroxidase [Oryza sativa (japonica cultivar-group)] >gi|55701015|tpe|CAH69316.1| TPA: class III peroxidase 74 precursor [Oryza sativa (japonica cultivar-group)] >gi|113579506|dbj|BAF17869.1| Os05g0499300 [Oryza sativa (japonica cultivar-group)] >gi|125552868|gb|EAY98577.1| hypothetical protein OsI_20490 [Oryza sativa Indica Group] >gi|125594768|gb|EAZ34827.1| hypothetical protein OsJ_018310 [Oryza sativa (japonica cultivar-group)] >gi|215694964|dbj|BAG90155.1| unnamed protein product [Oryza sativa Japonica Group] >gi|215740881|dbj|BAG97037.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1323
Evalue 8.43022e-144
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13856
ggcaagcttcttcttcctgattaatactccagttgcctggccatcgatcgtcgtcctcgcattgcctagcggagaaggaagcggagatagttggcttctg
gcgtgtggaGATGGCGTCGAGGGctatgATGGTGGCGGTGCTGCTCGCGGCGGTGGCGGCGACggcaACGTGCGCGCGGGCGCAGCTGGACGAGAAGTTC
TACAGCGAGTCGTGCCCCAGCGTGGAGGACGTCGTGAGGAGGGAGATGGTGAGGGCGCTGTCCCTGGCGCCCAGCCTCGCCGGGCCGCTCCTCCGGATGC
ACTTCCACGACTGCTTCGTCAGGGGGTGCGACGGCTCGGTTCTGCTGGACTCGGCCAACAAGACGGCGGAGAAGGACGCGCAGCCGAACCAGACGCTCCG
TGGCTTCGGCTTCGTCGAGAGGGTGAAGGCCGCCGTGGAGAAGGCCTGCCCTGACACCGTCTCCTGCGCCGACATACTCGCCCTCATGGCCAGGGACGCA
GTCTGGCTGAGCAAGGGCCCATTCTGGGAAGTTCCTTTGGGCCGGCGTGACGGCAGCGTGTCCatctcCAACGAGACCaaccagctgccacccccgaccg
ccaacttcaccgtgctcacccagctcttcgccgccaagaacctcgactCCAAGGACCTCGTCGTCCTCTCCGCCGGGCACACCATCGGGACGTCGCACTG
CTTCTCCTTCTCCGACCGTCTCTACAACTTCACCGGCAGGGTGAACCCCACCGACATTGaccccacACTGGAACCGCAGTACATGGCGAAGCTGAGGAAC
AAGTGCACCAGCCTCAACGACAACACCaccctCGTGGAGATGGaccccgggaGCTTCAGGACCTTCGACCTCGCCTACTTCAAGAACGTCGTCAAGCGGA
GGGGCCTCTTCCACTCCGACGGCGCGCTGCTCACCAACGCCTTCACCCGCGCCTACGTCGAGCGCCATGCCGGCGgcagcTACAAGGAGGAGTTCTTCGC
CGACTTCGCCGCCTCCATGATCAAGATGGGCAACGCCGACGTGCTCACTGGGAGCCAGGGCGAGATCAGGAAGAAGTGCAACGTACCCAATCATTAACTG
ACCGAGGCAGAAAGGGCCGCCGTTCGcagctAGCATGACAAcgggttgATGAGGCTTCTCATTTGTGACCAtctttttttcCTTTTAGATTGCTTCCTCC
ctcctgatccatcACACACCCCACGCCACACGCACCCCAGTTTTCACTTtattgATTGATTGTTTTGTTTTgtgacATCCATGTAAAgttgcTCCAAGAA
CTCAGTCAcaataaacc
page-top