Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13819  (registered. 2007)
Contig Information
Length 1226 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_SL Seed DPA30 6
Wh_oh Pistil at heading date 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit hypothetical protein OsJ_000174 [Oryza sativa (japonica cultivar-group)]
Score 384
Evalue 5.82713e-35
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13819
gaggaattcggcacgagggcCCGCACaccccgGCTCTGCTCCGAGCCGCCCccattgAGGGCTGCCCGCCCATGGCGGAAGAACCTCCGGTGAAGagcac
CAAGACGGAGGaggaCcttggtgcggggtcagagcCAGACGcggcggcggctgCGGCGGCGGCGGCGGcGGAAgaaggggaGAGGCcgagcGGCGAGGTG
ACCGTCAAGATACAGTCCAAAGCTCTCCGCTGCAGGATCTGCTCCGAGCCCCTCAAGCCGCCCATCTTCAAGTGTGCGGCTGGGCACGTTTTGTGTTCTC
AGTGCCCGGAAAAGCTCCGTGAGGTTGGGCACGTTTTGAGGCTGGGTACATTCTGCGCTCTGTGTTGCAAAAGCACTAGCTATTCCCGCTGCGTCGAGCT
CGAGCAGTTCATCGACGCCATGAAAGTGCCATGCTCGAACCAAACATACGGCTGCAACGAGTTCGTCGGCTACCAGCAGAAAGAGAAGCATGAGAGTTCA
TGCCCACATGCTCCATGCTACTGCCCAG*AGGATGACTGCGCCTTCAAAGCGCCGGCATGTTGCCTGCTGGACCACTTCGTCACCGCGCACGGATGGTCG
CCGACCAACTTGGGTTACAACAAGCCACTGAAGATCCTCTTGGCACGAGACCGCCGGTTCACGCTTCTGGTTGGGGAGGACATGTCCTTGTTCCTCCTGA
TCAACACCCTGACCAGCATCGGCAGTGCTCTCGCCGTGGTCTGCGTCAGGCCCCACGAGTCTGAACCGAGCTATTCGTGCAACATCTCTGCTGCTGCTCA
TGGTGTCGCTGGTGGGAAAACCGATGGGAGGCTCGTGTTCCAGAAGGATCCTCACGTGTCAAGCAGcctCGCTGGCGGGTGGAGTTCAGATGGGCAACTT
CTTCCTGCTGGTTCCTCTGGAA*TTCGCCGAGACCTCATCTGGTGAACTCACTGTACACATCCGCATCGACAGAGTGGCGCCATAGGGATGGATCTCAGC
TGGAAGCTACCATATGCTGTCAATGACTGCATATGGTGAAACAGCTAGCTAGATGTTGTCCAATGCTCTTTAATCACCATCAGCTGGAGGAACTAAAATG
TGTTTGTAGTGGCAGTAGAATTTATCTTTGCTTAGCTTGTTGTCTTGTTATGTATCTTATGTAACTCAGTTGTCCCAATGGAAGATCAGTAtcttgCAAC
TCAAAATTGTACTCATTTGTCAAgtt
page-top