Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13810  (registered. 2007)
Contig Information
Length 1557 bp
Clones 9 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_r Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0178000 [Oryza sativa (japonica cultivar-group)] >gi|15289767|dbj|BAB63467.1| putative aspartate aminotransferase [Oryza sativa Japonica Group] >gi|113531719|dbj|BAF04102.1| Os01g0178000 [Oryza sativa (japonica cultivar-group)] >gi|125524650|gb|EAY72764.1| hypothetical protein OsI_00629 [Oryza sativa Indica Group] >gi|125569247|gb|EAZ10762.1| hypothetical protein OsJ_000587 [Oryza sativa (japonica cultivar-group)]
Score 1781
Evalue 0
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13810
ggttgttgtccgagaatatttaggcccgcccccttcttccttcccgccgcctcgcctcccttctctGCTCCGTCTCCTCGGATCTCCGCCTCAAATTTGC
CTCCCCAATCCCCAGTTCCAGGTTCTTGGAGGAGGGGGG*AAGCCATGGGCAGCTTCGCCAAGCTGGCCAAGAGGTGCGTGGAGACGGAGGCGCCGGTCA
TGGTGAAGATACAAGAGCTGCTTCGAGGGGCCACGGATGTGATGTCGCTTGCGCAGGGAATTGTTTATTGGCAACCTCCTGAGGCAGCCCTGAACAAGGT
CAAGGAAATTGTATGGGAACCAGCAACCAGTAAATATGGTGCTGATGATGGCCTTCCCGAGCTTCGAGAAGCACTTCTCGAGAAGCTTCGCAGAGAGAAT
AAGCTAACCAAGTCATCAGTTATGGTGACCGCTGGTGCAAATCAGGCTTTTGTAAACCTGGTTCTGACCCTTTGCGATGCTGGTGATTCAGTTGTCATGT
TTGCACCATATTATTTCAATTCCTTCATGTCATTCCAGATGACTGGCGTCACTGATATATTAGTTGGTGCTAGCAATCCCAAGacactTCATCCTGatat
tgATTGgttagaGAAGGTGCTGAAAGAAAATAACCCTATCCCTAAACTTGTTACTGTTGTCAATCCGGGAAacccttcTGGAGCTTTTATTCCCAAGCCT
ATGCTACAGAGAATTTCAGACCTGTGCAGGAATGCTGGTGCATGGCTGGTGGTTGACAACACCT*ATGAGTACTTCATGTATGATAAAATGGAGCACTAC
TGCCtag*agGATGAtcatattgtcaaccttttctcgttctcaaaggcttatggcatgatggggtggcgagtaggaTACATTGCATATCCAAGTGAAGCC
GATGGTTTCCACGCGCAGCTCCTTAAGGTGCAAGATAACATACCTATCTGTGCTTCCATCATCGGGCAGCGCCTGGCTCTATACTCATTGGAGGCCGGCC
CAGAGTGGATCAGGGAAAGGGTGAATGATCTCGTGAAAAACCGCGAGCTGCTTGtggaagCAATGTCTCCCCTTGGTGAGGATGCTGTCAAGGGTGGGGA
GGGTGCCATCTATCTCTGGGCTAAACTACCAGATAACTGTTCAGACGACTTTGAGGTTGTCAGGTGGCTCGCGACCAAGCACGGCGTCGCAGTGATCCCC
GGGAGCGCCAGCGGAGGCCCCGGATACATCCGTGTTTCTTTTGGAGGACTGAAAGAAGAAGACACAAGGCTCGCCGGCGAGAGGCTAAGGCGGGGATTGC
AAGAGCTGGTGACCGATGGGATGGTACAGTAACAACAG*CCCACCGTATGTAAGACAGTAAGAGTACATTTCTACATTCAGATCACACAAGTCCGATTTT
TTCGACGATATGATTCTGCTGGGATTAGTTCATTCAGAGGAGCAAAAGCACCATATATCCAAGTCTTTTGTATCTTACAGAATCACCATGCTGGAGGTGC
CCAATAGGAATGGCAATTGGTGTAGTGAGAATTGGGGCAAAATAAAAAGCcatccag
page-top