Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13749  (registered. 2007)
Contig Information
Length 1134 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os01g0588900 [Oryza sativa (japonica cultivar-group)] >gi|53792247|dbj|BAD52880.1| lysine decarboxylase-like protein [Oryza sativa Japonica Group] >gi|113532970|dbj|BAF05353.1| Os01g0588900 [Oryza sativa (japonica cultivar-group)] >gi|125526628|gb|EAY74742.1| hypothetical protein OsI_02632 [Oryza sativa Indica Group] >gi|125571000|gb|EAZ12515.1| hypothetical protein OsJ_002340 [Oryza sativa (japonica cultivar-group)] >gi|215701209|dbj|BAG92633.1| unnamed protein product [Oryza sativa Japonica Group]
Score 1042
Evalue 2.58838e-111
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13749
cctTCCGCCCCTCCACCCCCTGGCCGCCCCAACACCGACGGATCAGGCGATGGCAGTGGAGGCCATGGCAGAGAAGAACACCGGCGCCGGCGTGGCTGGC
GGAGTAGCCCCGGAGAGCGGGGACAGGCGCTCCCGCTTCAGGCGGATCTGCGTCTACTGCGGCAGCGCCAAGGGCCGAAAGGCCAGCTACCAGGACGCCG
CCGTCGAGCTCGGCAAGGAGCTGGTGGAGAGGGGCATCGACCTGGTCTACGGAGGAGGCTCCATTGGGCTCATGGGCCTGGTCTCCCACGCAGTCCATGA
TGGAGGACGCCATGTGATTGGGGTCATCCCCAAGTCCTTGATGCCCAGAGAGGTCACTGGAGAGCCTGTTGGGGAAGTGAGAGCCGTCTCTGGCATGCAC
GAGAGGAAGGCCGAGATGGTTCGCTCTGCTGATGCTTTCATTGCCTTACCCGGTGGCTATGGGACTCTGGATGAGCTGCTCGAGGTCCTCACCTGGGCCC
AACTTGGGATCCACAAGAAGCCGATCGGGCTGCTCAACGTGGA*TGGGTTCTACAACTTCTTCCTGTCCTTCATAGACATGGCCGTGAGCGAAGGATTCA
TACAGGAGGACGCGA*GGCACCTCGTCATCTCAGCTCCTACCGCCAAGGAGCTAGTTCTCAAGCTCGAGGAGTATGTTCCGGACTACGAGATCGGGCTGG
TGTGGGAGGATCAGGGCCAGATCACGCACGGGTTCGCGCCGGAGCTGGAGCCCGGCATTGCGTCGTCATGATACAATTCATGGTGGAAGCGTTTCTGGAC
TAAGTAACATCTGACCGTGCAAACAAAAAAGAAAAAAAGGATGGGAGTGTGCTAGTCCTTGTCAGTCGTAGCTTTTGTGTGTCACTGCCAGTGGCATGAC
AGTGTTAGCATTGAGTAGCAAGTAGTGGTGCGGTTGATGATGGCGTTCTTTTGGTCGTAGCTTAGGTAGTAGAAGGAATGAAGGGATTGCATGTACAAAT
GTGTTATGTAGGAGCAGCAGCAGATGTGTGTTCCTTAATTATCAATCAAG*AATGGGAAATTCGTCTCGCTCTGTGTGGGTCATGGACGATGTGAAACAA
ATganatTCAAGTCGTAACGGAAGAAACGAACag
page-top