Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13653  (registered. 2007)
Contig Information
Length 892 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_e Seed DPA10 8
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit omega gliadin [Triticum aestivum]
Score 85
Evalue 0.00300335
Total Hit Count 1
Registered year 2007
Contig Sequence     [ Download ]
>Contig13653
cccaacaatcattcccccagcaaccagaacaaataattccccagcaaccgcaacaaccattccccctacaaccgcaacaaccattcccccagcaaccaga
acaaataatttcccagcaatcccaacaaccattctctctgcagccacaacaaccattttcccagccccaacaaccattatcccagcaaccaggacaaata
attccccagcaatcccaacaaccatgccccctncaaccacaacaaccattcccccagcaac*cagaacaaataattcgccAGCAACCGCAACAACCATTC
CTCCTACAATC*GCAACAACCATTCCACCAGCAACCAGAACAAATAATTTCTCAGCAACCCCAAAAACCATTCTCTCTGCagCCCCAACAACCATTTTCC
CAGCCCCAACAACCATTTC*CCCAGCAACCAGGACAAATAATTCCCCAG*CAACCCCAACAACCATTCTCCCTGCAACCTCAACAACCATTCCCCCA*G*
CAACTCCAACAACCATT*CGCTCTGCAACCACAACAAT*CGTTCCC*CCAGCAACCACAACAACCATTTCCCCAACCCCAACAAGCATTCCCAG*AACAA
GCAGAACAG*ATAATTCCCCAGCAACCCTAACAACCATTCC*CTCTGCAGCCACACCAACCTCAGCAACCTTATCCACAACAACAACCATCTGGAGTAGC
GGTATAGGCATCAGGGGCCAATGAAACGAAGAGCTATAGTACTAGACCGGTGGATCATCGGCGTTTAGTCAATGGAGTGTTCAGTGTAACGATGATAAAT
AAAAGTGATGTGTACCATCATGTGTAACACCGACCTATACTAGTTCAAACATGAG*AATAAAAGACAAAGAAAGTTattgtcaaaaaaaaaa
page-top