Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13636  (registered. 2007)
Contig Information
Length 947 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh_SL Seed DPA30 2
Wh_f Spike at flowering date 4
Wh_yf Spikelet at early flowering 2
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit Os12g0165700 [Oryza sativa (japonica cultivar-group)] >gi|108862239|gb|ABA95889.2| transcription elongation factor, putative, expressed [Oryza sativa (japonica cultivar-group)] >gi|113648751|dbj|BAF29263.1| Os12g0165700 [Oryza sativa (japonica cultivar-group)] >gi|125535897|gb|EAY82385.1| hypothetical protein OsI_37597 [Oryza sativa Indica Group]
Score 968
Evalue 7.45495e-103
Total Hit Count 250
Registered year 2007
Contig Sequence     [ Download ]
>Contig13636
ttttttttTTCTCAAATATATAACCTTGGTCCTTTTATCAGTAGTACTAGTATTATATCTTGACTTGGTTGTGCTGGACAATATTTCAGCGGACCAGATA
ACCAGTGTAACTAAACAAAA*GAACAAACATAAACCTTTCGTGCTCAATTTATTTTTCATTTTGAACCTTGCCGCGGCTAAGAATTTGCATGTTCACCAG
GTCACCGATGTCGGCCAGGGAGGCCACCTCCACCAGGCTTGCGGATGAAGGTGTTTTTATTTTTCGGCTTGGGTATGTCGTGGATATCCAGCACTTGCAT
TGTCCTCTGTTTTTTCGCATTTTGTGCTTCCTGGTAATTTTCTTGAAGCCTCTTTCTGGCTGAATCGAGCTTCTCGTCCAAATGATTATCCTTCTGCTCC
CTCATCGCCCTAGCTGGAGCAGATGACGAAGTAGTTGAATAGTTATTGCCATTGTTCTGCTTCGTATGATACGTAGGAGCTGGGCTTGCTCTATGCCTCT
CCAGTGTCGACTCGAACCCATTGTTATTCCTAGACCGCTCTGAACTCAAACCACTGTGCCTCTGTGGTGGGCTGGGCGTATACTTGAAGTCTGAAACCCG
GGCATTTTGGTAGCTTTTGCCTTGAGTCTTCTCAGGAGAGTCACCATCAGTTAGGATCGAATTTCCACCGTCACCACCAGAGTTGTGGAGCCGCACCCAG
CCGTCCACTATCTCCTTCCATTTCCTGACGAGCAGCTTCACTAACTGCCGGACGTCACCCGAAGGGTGCTTGCGCAGGCCATTCACATGTCGGCCGATGT
CCGTCTCCTGGAGAGCCTTGTAGGTGATGTCCATGTCTGCCAGGTTCTGCAGCAGGCTCACGAGCTCCTCCTCCGACTGGTCGGGGTCCTCCAAGAAATC
CTTGATCGCCAGGATCTTGCTCTCCAAGCCGCCGCCCTCGTCGGtcc
page-top