Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13618  (registered. 2007)
Contig Information
Length 1222 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 2
Wh_e Seed DPA10 2
Wh_h Spike at heading date 1
Wh_r Root 3
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit putative cellulose synthase catalytic subunit [Hordeum vulgare]
Score 884
Evalue 6.08012e-93
Total Hit Count 404
Registered year 2007
Contig Sequence     [ Download ]
>Contig13618
ctAGATAGAGGAAGAAGATAGCAAGCTAACAATCCCTACCATGAATGGGCAGCAAGCATGCAGGCATTTTTCCATGTTCGAAGCTTTCCAAACAAGCTAG
ATAAATAATGTGCAGCTTCCTCTATTACAAACGGCATTCTTGCCTTACAG*AG*AGAAAATACAAGTTGTTTTCAGTTTGTACATACATAATAATACATC
CTTCGGGCATAGCATTACAGACGACAGCTCTCAGTTTCGGCTCACTTACATACATTTT*ATCCTCTCCATTCAAATCAAGGTCAACAAATAAAGAATCGC
TGGCTGGCTGGACAATGAAACAACACTGGAACTGACTGACTGACTGACTGACTTGCTGCCTGTATTCTTTCTTCTTCGTGGCCGAACTGCACAGAGGTGA
AGAAGGGTTGCCGCAGCCTCCCGTCTGCCCAAATATTTTGCATATATGAGGCCCAGCTACCCACCATGGAACAAAACCAATAACTTAACACTTGTTGCAT
GTTTGTTTTCTAT*CTACACAGGGGATGGAGGAATGGAAGAGAAAAAAATTATGGGCACAAAAACACCTTCAAAATTACTCCACATGATGACTGATGTTG
ATCCATCCTTTCATCTCCTAGGTGCAGTCCAGACCGCACTCCTCCAGAAGAGGGCCGTCGGT*CTTGGCGAGGAAAGGGTTCACACGCACCCACAGGAGC
GAGATGATCGAAGCCAACAGGATGGACCAGACGATGACGATCGTCGGGGTCCTGTTCTGCCTTCCAAGAAGACCCTTGAGGAACGGGTAAAGATGGACAA
TAACCCAGAATGCGAAGAAGAGCTTCCCGAAGAGAGGCCCCCATGACTCATATCCGTTGTTGATCGCGTTGGAGATGCCGGCAACCACCCCGATGAAGTT
CAGCAGGAGCAAGGTGGTCGGGGGTATCAGCAAGGTTGTCCATTTGAAGGTGTACAGTTCCGAGAACTCCTCATCATCTCCAGCCTTTGTTGTGACGGTG
AAGCTTGTGTCCACACCAGCTATCACCTTGAGAAGTCCTTGGAACACGGCAAAGAGATGGGCAGAGACACCTCCAATGACCCAGAACTGCTCATTCCTCC
ACCAATCGTCAACCGCGACACGAGCCCATCTCATTTCCAGAATACCCGTAGCAAAAATGCAGATGAAAAGTGACATGTACCAGATACTGGcaagattgct
aagctctggggtgatgaacttt
page-top