Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig13596  (registered. 2007)
Contig Information
Length 997 bp
Clones 8 Clones [Download: TSV  ,  FASTA ]
Wh Spike at meiosis 1
Wh_e Seed DPA10 1
Wh_f Spike at flowering date 1
Wh_h Spike at heading date 4
Wh_yd Spikelet at late flowering 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit glycine decarboxylase P subunit [x Tritordeum sp.]
Score 998
Evalue 2.69729e-106
Total Hit Count 500
Registered year 2007
Contig Sequence     [ Download ]
>Contig13596
aactcttctttgagcgttgttggccttccaagtgaatggctgacctttaggctcagttatcaacagcatctatggatatataagagtacacaatctaaga
ataactagattttctttccgtgtatggctaggacatcaaaaaagacctccattatttgtcctgtattcagagaagagtggaAATGCTAGCCAATATAGCT
AATTTCACTTTCAAATGGG*AATGGGG*AGGCAGTGCGGGTACAG*AGGATACAGGAGAAGGTGGCATTTGAGGAGAATATATACAGTACATGAGGGATT
TAGAAGCAAGCATGCTTCCCTCCTACAGGAAGCATGATAACTTCTTGACACTGTTTCACACACCAGG*ATCGTCATCATCAGAAGATTACGCGGTGGCAG
CTGCAGCTTCCTCCGCCACCTGGGATGCCTGCTGCAGAGTGCAGATCAGGTTGCGATCCCCGTACACGTTGTCCACACGACATGTCGTTGGCCAGAACTT
GGCACCCCGAAGCCACGCCGCCGGGAACGCAGCATACTCCCTAGAGTATGGCTTAGTCCATGCGTCACCCATCAGGAGTTGGGG*TGGGTGAGGAGCGCC
CTTCAGGACATTGTTGTGCGCATCTGCTTTGCCATTTTCTACCTGTGCAATTTCCTCCCTGATAGAGATAAGGGCATCACAGAACCTGTCTAGTTCAGCC
TTGCTTTCACTCTCAGTGGGTTCAATCATAAGTGTGCCTGGAACAGGCCATGACATGGTTGGTCCATGGAATCCATAGTCCATCAAGCGCTTCGCCACAT
CCTCGGGCTCAATACCGGCAGTTGCCTTGAACCCTCTTAGATCAATGATGAATTCATGGGCAACAGTTCCATTGACTCCACGGAAAAGAACCGGGTAGTG
TTTCTCCAGACGCTTTGCCATGTAGTTCGCGTTCAGGATAGCAATCTTTGAAGCTTCAGTGAGTCCCTGAGAGCCCATCATGGCTATGTAGGTGTac
page-top