Japanese | English  
Genome / Development
cDNA BLAST Tissue specific clones complex contig list (2012) Query Form  -------------------------- How to use Virtual Display (2012)  -------------------------- Related Sites Download

cDNA

Contig Detail

Contig9237  (registered. 2012)
Contig Information
Length 1316 bp
Clones alternative view 36 Clones [Download: TSV  ,  FASTA ]
Wh_SHC Shoot grown with cold treatment 12
WH_XR Roots, 18 day old plants were grown hydroponically 1
WH_XT Roots, 18 day old plants were grown hydroponically 1
WH_SP 3
WH_XA Root 1
WH_XB Root 17
WH_XD Root, treated at 50 microM Al for 6h 1
Assemble Result Assemble Viewer
Homology (BLAST) Top Hit gi|110591226|pdb|2DGA|A|A Chain A, Crystal Structure Of Hexameric Beta-Glucosidase In Wheat"
Score 603
Evalue 1.00E-170
Total Hit Count 1
Registered year 2012
Contig Sequence     [ Download ]
>Contig9237
TTTTTTTTTTAGAAAACAAGCACAAGGTCTCACTTTATATAAATAAATCGACGAGTTCCACAAGAACATGATTATTGAACACAAACGTTCAGCAAGCAAA
AGGGAAATAGTTCGGGCTGGGGCGGCAGCACAGATAAGCCCGACATAAAGAAAAAGAACACAACCTACAGAGCCCGCCGGAACCGGAAGCTGGCGAGCCA
CACCCTCCGGAGGCCAAGAAGGAGCCCATCCAATCCGCCGTGATCCCGACGCAAAGCGAGCATCCGCCATTACAGAATCGATCGAGGCTACTAATTCAAC
ATCCCCGGCAGTGAACTGAAACGGCCACATCCTCCCTTCATTTTATTGCACCCATCCGATTATTAATTTCTTCAAACTAACTGCATGCCATGCATCCAGC
CTTGGATTATTTGTTCGAACATAGCACCACTTCGTTCTCCATCATACAGAAACGGAAGCAGCTGTCATGGTTGCGTTGTTATTGGTAGTCTTAAGCAAGG
GTTTTGGGACGGAGTTGAACTTGGAGAACCACTTGGCCGACTTCTTGAGCTTGCGCTTGTTGCCGTCATTCTTGTCGATGTAGACAAGGCCGAACCGTGA
GCTGTAGCCGAGGCTCCATTCGAAGTTGTCGATCAGACCCCACGTGAAGTGGCCCCGCACGTCCGCGCCCTGGTCTATTGCGTCCTTGACGGCTGAGATG
TGGCGCTGGAGGTAGTCTAGCCTCTTCCAGTCATCCAATGGATCCGGCATGCTTTCGTCACCTTCCACGTCAGCGATTCCGTTCTCAGTGATGAACACGG
GTGGGTTTCCGTATTTCTCCTTCATGATCAGAAGGAGGTCTGTTAGGCCTTTTGGGTACATGTAGATCCAATAAGTCCCGGTTATAGGACCGATGTCATT
CCCATCACTTCCTGTAGTTTCTGAACTGGCGTAAGCGTCGTCGGTGTTCAGCGTTGGCGTAAAGTCTGGTGACATGTCAACATGCTTGGAGAATCTGGAG
GTGTAATAGTTGAGCCCCATGATGTCACATGACGACGCTAGTTTCTCTTGCTCCTCCTTGGTGAACATGGGTAGACGATCTCCGATCAGTGATCTCATGG
AGAAGGGGTAGTCACCACGAACCACTGGCTCCAGGAACCATCCCATGTTGTAGTCAATGGATCTTTCCCGGGCCTGGTCGTCGAGGAAGGAGTCTTGGTA
TGGCTCGTAACCCATTACGTCAAAAGCCATTCCTATTTTGGAATCTCCATGCATGTTGTAACGAGCTTTGAACAGCTGAACAGCCTCAGCATGAGCTAGG
AGGATGTGGTGACCAG
page-top